\
| Variant ID: vg1105269968 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5269968 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGAGATAATTCTACTCGCTGGTTCTCGAACCAATAAATTGTAGCAATCTCTTAACTTCAGATGGTCGAGGTACGACTACGGCAATAGCGTAGCAGTCCTC[G/A]
CACCACGACTTCAGATGGTCGAGGTACGACTACGACTGGTCTTTGACCAGCAGCGTAGTGGTCCTCGCACCAAGACTTCAATCGGTCGAGAGATAAGGCT
AGCCTTATCTCTCGACCGATTGAAGTCTTGGTGCGAGGACCACTACGCTGCTGGTCAAAGACCAGTCGTAGTCGTACCTCGACCATCTGAAGTCGTGGTG[C/T]
GAGGACTGCTACGCTATTGCCGTAGTCGTACCTCGACCATCTGAAGTTAAGAGATTGCTACAATTTATTGGTTCGAGAACCAGCGAGTAGAATTATCTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 0.50% | 1.44% | 4.78% | NA |
| All Indica | 2759 | 99.10% | 0.80% | 0.04% | 0.07% | NA |
| All Japonica | 1512 | 81.00% | 0.00% | 4.37% | 14.68% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.37% | 0.74% | NA |
| Indica I | 595 | 99.00% | 0.70% | 0.17% | 0.17% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.00% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 84.60% | 0.00% | 2.87% | 12.52% | NA |
| Tropical Japonica | 504 | 83.50% | 0.00% | 2.98% | 13.49% | NA |
| Japonica Intermediate | 241 | 63.90% | 0.00% | 12.03% | 24.07% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105269968 | G -> A | LOC_Os11g09840-LOC_Os11g09850 | intergenic_region ; MODIFIER | silent_mutation | Average:26.296; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg1105269968 | G -> DEL | N | N | silent_mutation | Average:26.296; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105269968 | NA | 1.38E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105269968 | NA | 3.66E-06 | mr1544 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105269968 | NA | 8.75E-06 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105269968 | 8.70E-06 | NA | mr1599 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105269968 | NA | 1.91E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105269968 | NA | 8.91E-07 | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |