\
| Variant ID: vg1105257664 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5257664 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 73. )
GCTAAATAAATCGACAACCCAAAACTCCCTTATCCTATCTCGATATTGTCACTCTCTCAAACTCTCGCCCGGCGATTACTTAAAACCCCTCTATCAACTC[A/G]
AACCCGATGAACCCCCTCGAATATGTATAATCGATCGGTGTATTTATTTACCGTGCGTCGATTCGAATATCTCGATTTTATTACTACCACAACGATTGGA
TCCAATCGTTGTGGTAGTAATAAAATCGAGATATTCGAATCGACGCACGGTAAATAAATACACCGATCGATTATACATATTCGAGGGGGTTCATCGGGTT[T/C]
GAGTTGATAGAGGGGTTTTAAGTAATCGCCGGGCGAGAGTTTGAGAGAGTGACAATATCGAGATAGGATAAGGGAGTTTTGGGTTGTCGATTTATTTAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.50% | 3.70% | 0.08% | 71.73% | NA |
| All Indica | 2759 | 8.90% | 1.20% | 0.11% | 89.78% | NA |
| All Japonica | 1512 | 58.70% | 9.10% | 0.00% | 32.21% | NA |
| Aus | 269 | 0.00% | 0.00% | 0.00% | 100.00% | NA |
| Indica I | 595 | 4.20% | 2.90% | 0.00% | 92.94% | NA |
| Indica II | 465 | 3.90% | 0.40% | 0.22% | 95.48% | NA |
| Indica III | 913 | 7.30% | 0.10% | 0.00% | 92.55% | NA |
| Indica Intermediate | 786 | 17.30% | 1.70% | 0.25% | 80.79% | NA |
| Temperate Japonica | 767 | 61.10% | 17.10% | 0.00% | 21.77% | NA |
| Tropical Japonica | 504 | 65.50% | 0.40% | 0.00% | 34.13% | NA |
| Japonica Intermediate | 241 | 36.50% | 2.10% | 0.00% | 61.41% | NA |
| VI/Aromatic | 96 | 3.10% | 0.00% | 0.00% | 96.88% | NA |
| Intermediate | 90 | 23.30% | 4.40% | 1.11% | 71.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105257664 | A -> DEL | N | N | silent_mutation | Average:10.91; most accessible tissue: Callus, score: 60.798 | N | N | N | N |
| vg1105257664 | A -> G | LOC_Os11g09820.1 | upstream_gene_variant ; 2687.0bp to feature; MODIFIER | silent_mutation | Average:10.91; most accessible tissue: Callus, score: 60.798 | N | N | N | N |
| vg1105257664 | A -> G | LOC_Os11g09840.1 | upstream_gene_variant ; 4486.0bp to feature; MODIFIER | silent_mutation | Average:10.91; most accessible tissue: Callus, score: 60.798 | N | N | N | N |
| vg1105257664 | A -> G | LOC_Os11g09830.1 | downstream_gene_variant ; 440.0bp to feature; MODIFIER | silent_mutation | Average:10.91; most accessible tissue: Callus, score: 60.798 | N | N | N | N |
| vg1105257664 | A -> G | LOC_Os11g09820-LOC_Os11g09830 | intergenic_region ; MODIFIER | silent_mutation | Average:10.91; most accessible tissue: Callus, score: 60.798 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105257664 | NA | 1.10E-07 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105257664 | NA | 5.39E-07 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105257664 | 1.02E-06 | 2.70E-09 | mr1624_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |