\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105209609:

Variant ID: vg1105209609 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5209609
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATAGCGAAAATAATGACTACTTACTATTATTCTAAATTAATTACTACAAACAAATTTGTACAAAATTTGATATGTTATTATCAAGTAGTGCACTAATT[C/G]
ACTTCCTTATTTCATCGACATGTTGACTAAAAAAAATGGAAAAGGCAAACATATCCTCCACATTTTTTAAAAAAAATTGTTAACATACCCTCCAACATGT

Reverse complement sequence

ACATGTTGGAGGGTATGTTAACAATTTTTTTTAAAAAATGTGGAGGATATGTTTGCCTTTTCCATTTTTTTTAGTCAACATGTCGATGAAATAAGGAAGT[G/C]
AATTAGTGCACTACTTGATAATAACATATCAAATTTTGTACAAATTTGTTTGTAGTAATTAATTTAGAATAATAGTAAGTAGTCATTATTTTCGCTATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 0.10% 0.61% 9.39% NA
All Indica  2759 99.50% 0.00% 0.04% 0.47% NA
All Japonica  1512 70.10% 0.10% 1.52% 28.31% NA
Aus  269 96.30% 1.90% 1.86% 0.00% NA
Indica I  595 99.30% 0.00% 0.00% 0.67% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 99.00% 0.00% 0.13% 0.89% NA
Temperate Japonica  767 61.40% 0.10% 1.17% 37.29% NA
Tropical Japonica  504 77.80% 0.00% 1.79% 20.44% NA
Japonica Intermediate  241 81.70% 0.00% 2.07% 16.18% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 0.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105209609 C -> DEL N N silent_mutation Average:14.888; most accessible tissue: Zhenshan97 flower, score: 26.922 N N N N
vg1105209609 C -> G LOC_Os11g09750.1 upstream_gene_variant ; 294.0bp to feature; MODIFIER silent_mutation Average:14.888; most accessible tissue: Zhenshan97 flower, score: 26.922 N N N N
vg1105209609 C -> G LOC_Os11g09760.1 downstream_gene_variant ; 1352.0bp to feature; MODIFIER silent_mutation Average:14.888; most accessible tissue: Zhenshan97 flower, score: 26.922 N N N N
vg1105209609 C -> G LOC_Os11g09750-LOC_Os11g09760 intergenic_region ; MODIFIER silent_mutation Average:14.888; most accessible tissue: Zhenshan97 flower, score: 26.922 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105209609 NA 2.80E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 4.82E-07 4.82E-07 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 NA 2.39E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 NA 9.21E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 NA 9.38E-06 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 NA 1.03E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 1.33E-06 1.79E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 3.13E-06 2.53E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 3.22E-08 3.22E-08 mr1649 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 5.11E-07 2.35E-09 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 NA 4.34E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 NA 7.37E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 NA 1.03E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609 NA 6.25E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251