Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105209609:

Variant ID: vg1105209609 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5209609
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATAGCGAAAATAATGACTACTTACTATTATTCTAAATTAATTACTACAAACAAATTTGTACAAAATTTGATATGTTATTATCAAGTAGTGCACTAATT[C/G]
ACTTCCTTATTTCATCGACATGTTGACTAAAAAAAATGGAAAAGGCAAACATATCCTCCACATTTTTTAAAAAAAATTGTTAACATACCCTCCAACATGT

Reverse complement sequence

ACATGTTGGAGGGTATGTTAACAATTTTTTTTAAAAAATGTGGAGGATATGTTTGCCTTTTCCATTTTTTTTAGTCAACATGTCGATGAAATAAGGAAGT[G/C]
AATTAGTGCACTACTTGATAATAACATATCAAATTTTGTACAAATTTGTTTGTAGTAATTAATTTAGAATAATAGTAAGTAGTCATTATTTTCGCTATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	0.10%	0.61%	9.39%	NA
All Indica	2759	99.50%	0.00%	0.04%	0.47%	NA
All Japonica	1512	70.10%	0.10%	1.52%	28.31%	NA
Aus	269	96.30%	1.90%	1.86%	0.00%	NA
Indica I	595	99.30%	0.00%	0.00%	0.67%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	99.00%	0.00%	0.13%	0.89%	NA
Temperate Japonica	767	61.40%	0.10%	1.17%	37.29%	NA
Tropical Japonica	504	77.80%	0.00%	1.79%	20.44%	NA
Japonica Intermediate	241	81.70%	0.00%	2.07%	16.18%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	0.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105209609	C -> DEL	N	N	silent_mutation	Average:14.888; most accessible tissue: Zhenshan97 flower, score: 26.922	N	N	N	N
vg1105209609	C -> G	LOC_Os11g09750.1	upstream_gene_variant ; 294.0bp to feature; MODIFIER	silent_mutation	Average:14.888; most accessible tissue: Zhenshan97 flower, score: 26.922	N	N	N	N
vg1105209609	C -> G	LOC_Os11g09760.1	downstream_gene_variant ; 1352.0bp to feature; MODIFIER	silent_mutation	Average:14.888; most accessible tissue: Zhenshan97 flower, score: 26.922	N	N	N	N
vg1105209609	C -> G	LOC_Os11g09750-LOC_Os11g09760	intergenic_region ; MODIFIER	silent_mutation	Average:14.888; most accessible tissue: Zhenshan97 flower, score: 26.922	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105209609	NA	2.80E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	4.82E-07	4.82E-07	mr1166	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	NA	2.39E-08	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	NA	9.21E-08	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	NA	9.38E-06	mr1379	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	NA	1.03E-07	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	1.33E-06	1.79E-11	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	3.13E-06	2.53E-09	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	3.22E-08	3.22E-08	mr1649	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	5.11E-07	2.35E-09	mr1765	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	NA	4.34E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	NA	7.37E-08	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	NA	1.03E-10	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105209609	NA	6.25E-06	mr1703_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251