Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105201111:

Variant ID: vg1105201111 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5201111
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATAAAGTTGTAAATCTTGATAAGTTATACAACTTTGTTGTCGACAATTTTTCCATTTGAAATCATTTAGTATTTGAAAATGTTGTTTGAAGTTGTCATA[A/C]
GTTGTCATATTTTCAAATTCAAATTCAAACCGTTAAAAAAAAGTTATATAGAAAAATAACCAAAATAAAAGTTGTAAATCTTGATAGGTTATACAACTTT

Reverse complement sequence

AAAGTTGTATAACCTATCAAGATTTACAACTTTTATTTTGGTTATTTTTCTATATAACTTTTTTTTAACGGTTTGAATTTGAATTTGAAAATATGACAAC[T/G]
TATGACAACTTCAAACAACATTTTCAAATACTAAATGATTTCAAATGGAAAAATTGTCGACAACAAAGTTGTATAACTTATCAAGATTTACAACTTTATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.00%	3.40%	0.25%	11.32%	NA
All Indica	2759	87.60%	0.40%	0.25%	11.74%	NA
All Japonica	1512	89.20%	3.60%	0.07%	7.14%	NA
Aus	269	55.40%	10.00%	1.49%	33.09%	NA
Indica I	595	73.60%	1.00%	0.17%	25.21%	NA
Indica II	465	95.70%	0.00%	0.00%	4.30%	NA
Indica III	913	92.10%	0.10%	0.22%	7.56%	NA
Indica Intermediate	786	88.30%	0.40%	0.51%	10.81%	NA
Temperate Japonica	767	85.80%	3.70%	0.13%	10.43%	NA
Tropical Japonica	504	99.40%	0.20%	0.00%	0.40%	NA
Japonica Intermediate	241	78.40%	10.80%	0.00%	10.79%	NA
VI/Aromatic	96	24.00%	67.70%	0.00%	8.33%	NA
Intermediate	90	86.70%	6.70%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105201111	A -> DEL	N	N	silent_mutation	Average:15.717; most accessible tissue: Callus, score: 20.99	N	N	N	N
vg1105201111	A -> C	LOC_Os11g09740.1	upstream_gene_variant ; 1094.0bp to feature; MODIFIER	silent_mutation	Average:15.717; most accessible tissue: Callus, score: 20.99	N	N	N	N
vg1105201111	A -> C	LOC_Os11g09735.1	downstream_gene_variant ; 3949.0bp to feature; MODIFIER	silent_mutation	Average:15.717; most accessible tissue: Callus, score: 20.99	N	N	N	N
vg1105201111	A -> C	LOC_Os11g09750.1	downstream_gene_variant ; 4788.0bp to feature; MODIFIER	silent_mutation	Average:15.717; most accessible tissue: Callus, score: 20.99	N	N	N	N
vg1105201111	A -> C	LOC_Os11g09740-LOC_Os11g09750	intergenic_region ; MODIFIER	silent_mutation	Average:15.717; most accessible tissue: Callus, score: 20.99	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105201111	NA	4.21E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105201111	7.00E-08	1.12E-10	mr1913	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251