\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105199198:

Variant ID: vg1105199198 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5199198
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGTTGTTTTATTAATAAATCATGGGTACACTTATAATCTATTATATTATCTATATATTAGCATTGTTAGATTTACGGTGTTTAAAAAAAAATTGGGTC[G/A]
GACCACCCATAACCTAAATCCTAGATCCGCCGCTGCAATCGGGCATCCGGCCGTTACGGATGATACACATCTCAATCGGGCCAACACAAAAGCCCGTCAC

Reverse complement sequence

GTGACGGGCTTTTGTGTTGGCCCGATTGAGATGTGTATCATCCGTAACGGCCGGATGCCCGATTGCAGCGGCGGATCTAGGATTTAGGTTATGGGTGGTC[C/T]
GACCCAATTTTTTTTTAAACACCGTAAATCTAACAATGCTAATATATAGATAATATAATAGATTATAAGTGTACCCATGATTTATTAATAAAACAACCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 26.60% 2.77% 11.00% NA
All Indica  2759 42.20% 43.70% 1.41% 12.72% NA
All Japonica  1512 96.90% 1.50% 1.19% 0.40% NA
Aus  269 21.60% 0.40% 25.28% 52.79% NA
Indica I  595 25.20% 49.20% 0.17% 25.38% NA
Indica II  465 14.00% 81.30% 0.00% 4.73% NA
Indica III  913 63.90% 26.10% 1.97% 8.11% NA
Indica Intermediate  786 46.40% 37.80% 2.54% 13.23% NA
Temperate Japonica  767 97.00% 2.60% 0.13% 0.26% NA
Tropical Japonica  504 96.20% 0.00% 3.17% 0.60% NA
Japonica Intermediate  241 97.90% 1.20% 0.41% 0.41% NA
VI/Aromatic  96 80.20% 1.00% 4.17% 14.58% NA
Intermediate  90 61.10% 28.90% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105199198 G -> A LOC_Os11g09735.1 downstream_gene_variant ; 2036.0bp to feature; MODIFIER silent_mutation Average:81.444; most accessible tissue: Zhenshan97 panicle, score: 95.602 N N N N
vg1105199198 G -> A LOC_Os11g09740.1 intron_variant ; MODIFIER silent_mutation Average:81.444; most accessible tissue: Zhenshan97 panicle, score: 95.602 N N N N
vg1105199198 G -> DEL N N silent_mutation Average:81.444; most accessible tissue: Zhenshan97 panicle, score: 95.602 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1105199198 G A 0.01 -0.01 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105199198 NA 1.75E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105199198 NA 2.44E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105199198 NA 3.51E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105199198 NA 1.83E-32 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105199198 NA 2.07E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105199198 NA 1.75E-23 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105199198 NA 7.20E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105199198 NA 6.17E-18 mr1260_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105199198 NA 6.64E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251