\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105189380:

Variant ID: vg1105189380 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5189380
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.16, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGGGGCTCATCAGTCATCACAAGCAAATCTTTTGGCTTTGTACCCCGTCCGGCCGTCCCAGACTTAGCCTTCTTGGCCACCAACAAAATCCAACGCCG[T/C]
GAAGCCATCTCGTCCATGGAGCGGCGATGGCGAGCACGTTTGATGATGATATATGCCAACATGCCAACAATACGATGTGCGTCGTCGTGACTTGTTGTGA

Reverse complement sequence

TCACAACAAGTCACGACGACGCACATCGTATTGTTGGCATGTTGGCATATATCATCATCAAACGTGCTCGCCATCGCCGCTCCATGGACGAGATGGCTTC[A/G]
CGGCGTTGGATTTTGTTGGTGGCCAAGAAGGCTAAGTCTGGGACGGCCGGACGGGGTACAAAGCCAAAAGATTTGCTTGTGATGACTGATGAGCCCCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 10.20% 0.89% 31.49% NA
All Indica  2759 49.10% 0.80% 0.51% 49.58% NA
All Japonica  1512 69.40% 29.30% 0.00% 1.26% NA
Aus  269 65.40% 0.70% 9.29% 24.54% NA
Indica I  595 24.20% 2.90% 0.34% 72.61% NA
Indica II  465 20.00% 0.40% 1.29% 78.28% NA
Indica III  913 72.90% 0.00% 0.22% 26.83% NA
Indica Intermediate  786 57.50% 0.40% 0.51% 41.60% NA
Temperate Japonica  767 64.00% 33.80% 0.00% 2.22% NA
Tropical Japonica  504 85.90% 14.10% 0.00% 0.00% NA
Japonica Intermediate  241 52.30% 46.90% 0.00% 0.83% NA
VI/Aromatic  96 85.40% 4.20% 1.04% 9.38% NA
Intermediate  90 54.40% 14.40% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105189380 T -> DEL N N silent_mutation Average:13.045; most accessible tissue: Callus, score: 62.089 N N N N
vg1105189380 T -> C LOC_Os11g09720.1 downstream_gene_variant ; 1424.0bp to feature; MODIFIER silent_mutation Average:13.045; most accessible tissue: Callus, score: 62.089 N N N N
vg1105189380 T -> C LOC_Os11g09730.1 downstream_gene_variant ; 2990.0bp to feature; MODIFIER silent_mutation Average:13.045; most accessible tissue: Callus, score: 62.089 N N N N
vg1105189380 T -> C LOC_Os11g09720-LOC_Os11g09730 intergenic_region ; MODIFIER silent_mutation Average:13.045; most accessible tissue: Callus, score: 62.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105189380 4.09E-06 4.09E-06 mr1197 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105189380 6.83E-06 NA mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251