Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105162548:

Variant ID: vg1105162548 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5162548
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTTACAGAAGGAAGTGCAAAGCATACCGATAGCTGTGTTCAGTGGTGATTGTTGGGAACCTATCATCAACGCAAGGAAAAGAGCGATCCATTAGTGTA[T/C,A]
GATTAATTAAGTATTAGCTATTTTTTTAAAAAAATGGATCAATATGATTTTTTTAAGCAACTTTTGTATATAAACTTTTTTTAAAAAAAACACACCGTTT

Reverse complement sequence

AAACGGTGTGTTTTTTTTAAAAAAAGTTTATATACAAAAGTTGCTTAAAAAAATCATATTGATCCATTTTTTTAAAAAAATAGCTAATACTTAATTAATC[A/G,T]
TACACTAATGGATCGCTCTTTTCCTTGCGTTGATGATAGGTTCCCAACAATCACCACTGAACACAGCTATCGGTATGCTTTGCACTTCCTTCTGTAACTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	8.80%	0.13%	0.00%	C: 0.13%
All Indica	2759	99.30%	0.60%	0.04%	0.00%	NA
All Japonica	1512	74.10%	25.50%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.40%	0.13%	0.00%	NA
Temperate Japonica	767	93.70%	5.70%	0.52%	0.00%	NA
Tropical Japonica	504	40.10%	59.90%	0.00%	0.00%	NA
Japonica Intermediate	241	83.00%	16.60%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	0.00%	C: 6.25%
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105162548	T -> A	LOC_Os11g09660.1	upstream_gene_variant ; 1428.0bp to feature; MODIFIER	silent_mutation	Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844	N	N	N	N
vg1105162548	T -> A	LOC_Os11g09650.1	downstream_gene_variant ; 3700.0bp to feature; MODIFIER	silent_mutation	Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844	N	N	N	N
vg1105162548	T -> A	LOC_Os11g09670.1	downstream_gene_variant ; 1884.0bp to feature; MODIFIER	silent_mutation	Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844	N	N	N	N
vg1105162548	T -> A	LOC_Os11g09670.2	downstream_gene_variant ; 1884.0bp to feature; MODIFIER	silent_mutation	Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844	N	N	N	N
vg1105162548	T -> A	LOC_Os11g09660-LOC_Os11g09670	intergenic_region ; MODIFIER	silent_mutation	Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844	N	N	N	N
vg1105162548	T -> C	LOC_Os11g09660.1	upstream_gene_variant ; 1428.0bp to feature; MODIFIER	silent_mutation	Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844	N	N	N	N
vg1105162548	T -> C	LOC_Os11g09650.1	downstream_gene_variant ; 3700.0bp to feature; MODIFIER	silent_mutation	Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844	N	N	N	N
vg1105162548	T -> C	LOC_Os11g09670.1	downstream_gene_variant ; 1884.0bp to feature; MODIFIER	silent_mutation	Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844	N	N	N	N
vg1105162548	T -> C	LOC_Os11g09670.2	downstream_gene_variant ; 1884.0bp to feature; MODIFIER	silent_mutation	Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844	N	N	N	N
vg1105162548	T -> C	LOC_Os11g09660-LOC_Os11g09670	intergenic_region ; MODIFIER	silent_mutation	Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105162548	NA	6.36E-07	mr1042	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	8.53E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	3.17E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	6.92E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	1.64E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	1.75E-06	mr1269	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	8.41E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	1.01E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	1.17E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	2.21E-07	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	1.94E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	3.35E-08	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	2.30E-09	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	1.47E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	9.35E-06	mr1625	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	7.04E-10	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	3.41E-08	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	1.74E-06	2.48E-09	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	5.62E-09	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	6.43E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	1.15E-06	1.15E-06	mr1815	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	4.39E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	2.54E-13	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	2.75E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	5.74E-06	mr1990	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548	NA	1.74E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251