\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105162548:

Variant ID: vg1105162548 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5162548
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTACAGAAGGAAGTGCAAAGCATACCGATAGCTGTGTTCAGTGGTGATTGTTGGGAACCTATCATCAACGCAAGGAAAAGAGCGATCCATTAGTGTA[T/C,A]
GATTAATTAAGTATTAGCTATTTTTTTAAAAAAATGGATCAATATGATTTTTTTAAGCAACTTTTGTATATAAACTTTTTTTAAAAAAAACACACCGTTT

Reverse complement sequence

AAACGGTGTGTTTTTTTTAAAAAAAGTTTATATACAAAAGTTGCTTAAAAAAATCATATTGATCCATTTTTTTAAAAAAATAGCTAATACTTAATTAATC[A/G,T]
TACACTAATGGATCGCTCTTTTCCTTGCGTTGATGATAGGTTCCCAACAATCACCACTGAACACAGCTATCGGTATGCTTTGCACTTCCTTCTGTAACTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 8.80% 0.13% 0.00% C: 0.13%
All Indica  2759 99.30% 0.60% 0.04% 0.00% NA
All Japonica  1512 74.10% 25.50% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.40% 0.13% 0.00% NA
Temperate Japonica  767 93.70% 5.70% 0.52% 0.00% NA
Tropical Japonica  504 40.10% 59.90% 0.00% 0.00% NA
Japonica Intermediate  241 83.00% 16.60% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 0.00% C: 6.25%
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105162548 T -> A LOC_Os11g09660.1 upstream_gene_variant ; 1428.0bp to feature; MODIFIER silent_mutation Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg1105162548 T -> A LOC_Os11g09650.1 downstream_gene_variant ; 3700.0bp to feature; MODIFIER silent_mutation Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg1105162548 T -> A LOC_Os11g09670.1 downstream_gene_variant ; 1884.0bp to feature; MODIFIER silent_mutation Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg1105162548 T -> A LOC_Os11g09670.2 downstream_gene_variant ; 1884.0bp to feature; MODIFIER silent_mutation Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg1105162548 T -> A LOC_Os11g09660-LOC_Os11g09670 intergenic_region ; MODIFIER silent_mutation Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg1105162548 T -> C LOC_Os11g09660.1 upstream_gene_variant ; 1428.0bp to feature; MODIFIER silent_mutation Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg1105162548 T -> C LOC_Os11g09650.1 downstream_gene_variant ; 3700.0bp to feature; MODIFIER silent_mutation Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg1105162548 T -> C LOC_Os11g09670.1 downstream_gene_variant ; 1884.0bp to feature; MODIFIER silent_mutation Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg1105162548 T -> C LOC_Os11g09670.2 downstream_gene_variant ; 1884.0bp to feature; MODIFIER silent_mutation Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844 N N N N
vg1105162548 T -> C LOC_Os11g09660-LOC_Os11g09670 intergenic_region ; MODIFIER silent_mutation Average:65.981; most accessible tissue: Minghui63 flower, score: 77.844 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105162548 NA 6.36E-07 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 8.53E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 3.17E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 6.92E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 1.64E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 1.75E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 8.41E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 1.01E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 1.17E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 2.21E-07 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 1.94E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 3.35E-08 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 2.30E-09 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 1.47E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 9.35E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 7.04E-10 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 3.41E-08 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 1.74E-06 2.48E-09 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 5.62E-09 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 6.43E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 1.15E-06 1.15E-06 mr1815 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 4.39E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 2.54E-13 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 2.75E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 5.74E-06 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105162548 NA 1.74E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251