\
| Variant ID: vg1105129212 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5129212 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 109. )
TATTTTTGATTTTTTTCCCATTTGAAACTGCAAAAGCCTTTTCTTCTGGCCCGGTGCTCCATTTGCGAATTTTTTTTCATTTTTAAATTTTTATTTTTTA[A/G]
TATTTACAGAAATATTATACCATCTAAAATATTTACAAAAATGTCCCCTGCCGCCCAAGTGGAGAGCGGCAAGGTGTGCGCATTTTGCACTGAGATCCCT
AGGGATCTCAGTGCAAAATGCGCACACCTTGCCGCTCTCCACTTGGGCGGCAGGGGACATTTTTGTAAATATTTTAGATGGTATAATATTTCTGTAAATA[T/C]
TAAAAAATAAAAATTTAAAAATGAAAAAAAATTCGCAAATGGAGCACCGGGCCAGAAGAAAAGGCTTTTGCAGTTTCAAATGGGAAAAAAATCAAAAATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.10% | 22.20% | 0.11% | 51.61% | NA |
| All Indica | 2759 | 11.80% | 8.10% | 0.11% | 80.03% | NA |
| All Japonica | 1512 | 37.90% | 53.40% | 0.07% | 8.66% | NA |
| Aus | 269 | 78.10% | 0.00% | 0.00% | 21.93% | NA |
| Indica I | 595 | 32.60% | 2.90% | 0.17% | 64.37% | NA |
| Indica II | 465 | 3.00% | 3.40% | 0.22% | 93.33% | NA |
| Indica III | 913 | 2.70% | 7.00% | 0.00% | 90.25% | NA |
| Indica Intermediate | 786 | 11.70% | 16.00% | 0.13% | 72.14% | NA |
| Temperate Japonica | 767 | 43.50% | 53.20% | 0.00% | 3.26% | NA |
| Tropical Japonica | 504 | 18.10% | 64.50% | 0.00% | 17.46% | NA |
| Japonica Intermediate | 241 | 61.40% | 30.70% | 0.41% | 7.47% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 17.80% | 1.11% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105129212 | A -> DEL | N | N | silent_mutation | Average:45.55; most accessible tissue: Callus, score: 77.364 | N | N | N | N |
| vg1105129212 | A -> G | LOC_Os11g09580.1 | upstream_gene_variant ; 1806.0bp to feature; MODIFIER | silent_mutation | Average:45.55; most accessible tissue: Callus, score: 77.364 | N | N | N | N |
| vg1105129212 | A -> G | LOC_Os11g09590.1 | upstream_gene_variant ; 41.0bp to feature; MODIFIER | silent_mutation | Average:45.55; most accessible tissue: Callus, score: 77.364 | N | N | N | N |
| vg1105129212 | A -> G | LOC_Os11g09580-LOC_Os11g09590 | intergenic_region ; MODIFIER | silent_mutation | Average:45.55; most accessible tissue: Callus, score: 77.364 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105129212 | 2.55E-07 | NA | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105129212 | 9.36E-06 | 9.35E-06 | mr1262_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105129212 | NA | 6.84E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105129212 | NA | 5.27E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105129212 | 2.08E-06 | 4.71E-07 | mr1661_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105129212 | NA | 2.53E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105129212 | NA | 7.44E-08 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105129212 | NA | 2.10E-06 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |