Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105128161:

Variant ID: vg1105128161 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5128161
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TACATCATCGATGATCATGGTGAAACTTTTTGTCTATTCAAGGGACCTAAACATAAAGTTGGAAATGAATGGAAGTCGTTATCAATCAGATGTATCAGCT[G/A]
CAGTGTTGGAACATCTTAAGATTGTGGAAATCAAATGTGAAGTGGTTGATGAGAGAGTTCACGAAGTTTTGAAGTTCCTGAGTACACTAAACATATGTAA

Reverse complement sequence

TTACATATGTTTAGTGTACTCAGGAACTTCAAAACTTCGTGAACTCTCTCATCAACCACTTCACATTTGATTTCCACAATCTTAAGATGTTCCAACACTG[C/T]
AGCTGATACATCTGATTGATAACGACTTCCATTCATTTCCAACTTTATGTTTAGGTCCCTTGAATAGACAAAAAGTTTCACCATGATCATCGATGATGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.40%	41.80%	0.49%	8.32%	NA
All Indica	2759	21.60%	66.00%	0.58%	11.89%	NA
All Japonica	1512	91.50%	4.60%	0.20%	3.77%	NA
Aus	269	78.10%	20.10%	0.74%	1.12%	NA
Indica I	595	38.20%	48.90%	1.01%	11.93%	NA
Indica II	465	5.40%	90.30%	0.00%	4.30%	NA
Indica III	913	11.80%	72.00%	0.11%	16.10%	NA
Indica Intermediate	786	29.90%	57.50%	1.15%	11.45%	NA
Temperate Japonica	767	96.90%	2.30%	0.13%	0.65%	NA
Tropical Japonica	504	82.50%	7.90%	0.40%	9.13%	NA
Japonica Intermediate	241	92.90%	4.60%	0.00%	2.49%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	57.80%	34.40%	2.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105128161	G -> A	LOC_Os11g09580.1	upstream_gene_variant ; 755.0bp to feature; MODIFIER	silent_mutation	Average:44.187; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg1105128161	G -> A	LOC_Os11g09590.1	upstream_gene_variant ; 1092.0bp to feature; MODIFIER	silent_mutation	Average:44.187; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg1105128161	G -> A	LOC_Os11g09580-LOC_Os11g09590	intergenic_region ; MODIFIER	silent_mutation	Average:44.187; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg1105128161	G -> DEL	N	N	silent_mutation	Average:44.187; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105128161	4.77E-06	4.77E-06	mr1666	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105128161	8.94E-06	NA	mr1931	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105128161	NA	3.76E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105128161	NA	9.64E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105128161	NA	7.74E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105128161	NA	4.85E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251