\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104971625:

Variant ID: vg1104971625 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4971625
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, A: 0.38, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGCTGTCAAACATGTTAGCCGTCAGGTCCCGTCTCCTCCATGTCTACAGCCACAAGCATCCATGCCCTCTCCTACTCACTGCACATCAATAACAGTTT[A/C]
AGAATAGTAATATTGTGGTGAAAAGGATGCTCACTGCTCAGGCGATCAGTGTACAAACCTTGTTTAGAGCTCATCCTTGAGAGGCTCGGCTGGGGCCGAC

Reverse complement sequence

GTCGGCCCCAGCCGAGCCTCTCAAGGATGAGCTCTAAACAAGGTTTGTACACTGATCGCCTGAGCAGTGAGCATCCTTTTCACCACAATATTACTATTCT[T/G]
AAACTGTTATTGATGTGCAGTGAGTAGGAGAGGGCATGGATGCTTGTGGCTGTAGACATGGAGGAGACGGGACCTGACGGCTAACATGTTTGACAGCTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 33.70% 5.40% 6.88% NA
All Indica  2759 66.90% 16.60% 7.36% 9.13% NA
All Japonica  1512 25.00% 69.80% 2.51% 2.71% NA
Aus  269 72.50% 13.40% 4.83% 9.29% NA
Indica I  595 80.70% 17.30% 1.51% 0.50% NA
Indica II  465 88.80% 5.60% 3.66% 1.94% NA
Indica III  913 52.50% 13.00% 13.03% 21.47% NA
Indica Intermediate  786 60.40% 26.60% 7.38% 5.60% NA
Temperate Japonica  767 32.60% 67.10% 0.13% 0.13% NA
Tropical Japonica  504 12.10% 75.20% 5.36% 7.34% NA
Japonica Intermediate  241 27.80% 66.80% 4.15% 1.24% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 60.00% 31.10% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104971625 A -> DEL N N silent_mutation Average:90.898; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg1104971625 A -> C LOC_Os11g09280.2 3_prime_UTR_variant ; 64.0bp to feature; MODIFIER silent_mutation Average:90.898; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg1104971625 A -> C LOC_Os11g09260.1 upstream_gene_variant ; 4505.0bp to feature; MODIFIER silent_mutation Average:90.898; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg1104971625 A -> C LOC_Os11g09270.1 upstream_gene_variant ; 1583.0bp to feature; MODIFIER silent_mutation Average:90.898; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N
vg1104971625 A -> C LOC_Os11g09280.1 intron_variant ; MODIFIER silent_mutation Average:90.898; most accessible tissue: Zhenshan97 panicle, score: 95.016 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1104971625 A C -0.02 -0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104971625 NA 3.03E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 6.89E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 4.66E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 1.54E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 2.20E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 3.78E-06 mr1283_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 3.01E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 2.19E-06 mr1294_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 2.57E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 3.44E-06 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 7.81E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 4.36E-06 mr1345_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 4.27E-06 mr1351_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 1.02E-06 1.02E-06 mr1353_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 1.28E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 3.99E-06 mr1396_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 8.41E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 2.59E-06 2.59E-06 mr1512_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 4.30E-06 4.30E-06 mr1523_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 3.24E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 8.93E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 2.58E-06 mr1646_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 2.76E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 2.57E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 7.96E-08 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 9.25E-06 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 5.43E-07 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 6.45E-06 mr1785_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 5.16E-07 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 1.30E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 4.72E-06 4.72E-06 mr1804_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 1.15E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 4.72E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 9.42E-06 mr1890_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 4.75E-06 mr1906_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 1.70E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104971625 NA 4.30E-07 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251