\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104966583:

Variant ID: vg1104966583 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4966583
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.03, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


GATAGGCTTGCTTCCATTGCAATGGCATCAAAGCGAGGAACCTTCGTGGCGTCAGGTATCGCTATACACCACCAACCATCGAAACTAAATATTGGTTACA[C/T]
GAGTCTATTCTTTTTCTAATGATGACTTATATATTTTAAATCATATATTATTTTCATTTTTGTTTGTACCATCGTGCTCTACTCAAAATATACGATAAAA

Reverse complement sequence

TTTTATCGTATATTTTGAGTAGAGCACGATGGTACAAACAAAAATGAAAATAATATATGATTTAAAATATATAAGTCATCATTAGAAAAAGAATAGACTC[G/A]
TGTAACCAATATTTAGTTTCGATGGTTGGTGGTGTATAGCGATACCTGACGCCACGAAGGTTCCTCGCTTTGATGCCATTGCAATGGAAGCAAGCCTATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 29.00% 0.36% 32.67% NA
All Indica  2759 36.40% 47.10% 0.36% 16.17% NA
All Japonica  1512 29.10% 2.60% 0.40% 67.86% NA
Aus  269 86.60% 0.00% 0.00% 13.38% NA
Indica I  595 34.60% 47.90% 0.00% 17.48% NA
Indica II  465 9.50% 84.90% 0.22% 5.38% NA
Indica III  913 57.40% 29.40% 0.77% 12.49% NA
Indica Intermediate  786 29.10% 44.80% 0.25% 25.83% NA
Temperate Japonica  767 30.90% 3.80% 0.52% 64.80% NA
Tropical Japonica  504 25.20% 1.00% 0.20% 73.61% NA
Japonica Intermediate  241 31.50% 2.50% 0.41% 65.56% NA
VI/Aromatic  96 84.40% 1.00% 0.00% 14.58% NA
Intermediate  90 40.00% 34.40% 1.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104966583 C -> T LOC_Os11g09260.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 N N N N
vg1104966583 C -> T LOC_Os11g09260.1 5_prime_UTR_variant ; 617.0bp to feature; MODIFIER silent_mutation Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 N N N N
vg1104966583 C -> T LOC_Os11g09270.1 downstream_gene_variant ; 2308.0bp to feature; MODIFIER silent_mutation Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 N N N N
vg1104966583 C -> T LOC_Os11g09280.1 downstream_gene_variant ; 4665.0bp to feature; MODIFIER silent_mutation Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 N N N N
vg1104966583 C -> T LOC_Os11g09280.2 downstream_gene_variant ; 4665.0bp to feature; MODIFIER silent_mutation Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 N N N N
vg1104966583 C -> DEL N N silent_mutation Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104966583 NA 7.47E-19 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104966583 NA 1.50E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 9.72E-16 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 7.35E-06 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 4.53E-06 4.53E-06 mr1384 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 8.74E-16 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 1.33E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 3.35E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 3.52E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 2.83E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 4.58E-24 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 3.08E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 1.08E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 4.34E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 2.63E-18 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 5.03E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 1.15E-06 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 1.43E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 8.42E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 2.69E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 6.06E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 5.72E-06 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 4.92E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 5.67E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 8.87E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 1.80E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 1.27E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104966583 NA 4.72E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251