\
| Variant ID: vg1104966583 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4966583 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.03, others allele: 0.00, population size: 32. )
GATAGGCTTGCTTCCATTGCAATGGCATCAAAGCGAGGAACCTTCGTGGCGTCAGGTATCGCTATACACCACCAACCATCGAAACTAAATATTGGTTACA[C/T]
GAGTCTATTCTTTTTCTAATGATGACTTATATATTTTAAATCATATATTATTTTCATTTTTGTTTGTACCATCGTGCTCTACTCAAAATATACGATAAAA
TTTTATCGTATATTTTGAGTAGAGCACGATGGTACAAACAAAAATGAAAATAATATATGATTTAAAATATATAAGTCATCATTAGAAAAAGAATAGACTC[G/A]
TGTAACCAATATTTAGTTTCGATGGTTGGTGGTGTATAGCGATACCTGACGCCACGAAGGTTCCTCGCTTTGATGCCATTGCAATGGAAGCAAGCCTATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.90% | 29.00% | 0.36% | 32.67% | NA |
| All Indica | 2759 | 36.40% | 47.10% | 0.36% | 16.17% | NA |
| All Japonica | 1512 | 29.10% | 2.60% | 0.40% | 67.86% | NA |
| Aus | 269 | 86.60% | 0.00% | 0.00% | 13.38% | NA |
| Indica I | 595 | 34.60% | 47.90% | 0.00% | 17.48% | NA |
| Indica II | 465 | 9.50% | 84.90% | 0.22% | 5.38% | NA |
| Indica III | 913 | 57.40% | 29.40% | 0.77% | 12.49% | NA |
| Indica Intermediate | 786 | 29.10% | 44.80% | 0.25% | 25.83% | NA |
| Temperate Japonica | 767 | 30.90% | 3.80% | 0.52% | 64.80% | NA |
| Tropical Japonica | 504 | 25.20% | 1.00% | 0.20% | 73.61% | NA |
| Japonica Intermediate | 241 | 31.50% | 2.50% | 0.41% | 65.56% | NA |
| VI/Aromatic | 96 | 84.40% | 1.00% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 40.00% | 34.40% | 1.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104966583 | C -> T | LOC_Os11g09260.1 | 5_prime_UTR_premature_start_codon_gain_variant ; LOW | silent_mutation | Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 | N | N | N | N |
| vg1104966583 | C -> T | LOC_Os11g09260.1 | 5_prime_UTR_variant ; 617.0bp to feature; MODIFIER | silent_mutation | Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 | N | N | N | N |
| vg1104966583 | C -> T | LOC_Os11g09270.1 | downstream_gene_variant ; 2308.0bp to feature; MODIFIER | silent_mutation | Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 | N | N | N | N |
| vg1104966583 | C -> T | LOC_Os11g09280.1 | downstream_gene_variant ; 4665.0bp to feature; MODIFIER | silent_mutation | Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 | N | N | N | N |
| vg1104966583 | C -> T | LOC_Os11g09280.2 | downstream_gene_variant ; 4665.0bp to feature; MODIFIER | silent_mutation | Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 | N | N | N | N |
| vg1104966583 | C -> DEL | N | N | silent_mutation | Average:59.105; most accessible tissue: Minghui63 root, score: 83.258 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104966583 | NA | 7.47E-19 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1104966583 | NA | 1.50E-10 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 9.72E-16 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 7.35E-06 | mr1343 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | 4.53E-06 | 4.53E-06 | mr1384 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 8.74E-16 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 1.33E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 3.35E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 3.52E-10 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 2.83E-16 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 4.58E-24 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 3.08E-08 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 1.08E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 4.34E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 2.63E-18 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 5.03E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 1.15E-06 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 1.43E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 8.42E-09 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 2.69E-06 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 6.06E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 5.72E-06 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 4.92E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 5.67E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 8.87E-06 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 1.80E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 1.27E-07 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104966583 | NA | 4.72E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |