Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104927782:

Variant ID: vg1104927782 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4927782
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGACGTACTCATCACCAACGAGGTGCCCATGGTGATTTTGTCAACCTCAAAATATATGTCAGTCCAGTTTTTTGGAGGTGCTTATAGAAGTAGGATGCGC[G/A]
TGTGCGTGTTCATAGATACGAGCGTACGTGTATTGTTAGCATCTACTTTTATACCGTGTTTCTAATAAAAGGAAAATAATAATAATAATATTTACAGTAT

Reverse complement sequence

ATACTGTAAATATTATTATTATTATTTTCCTTTTATTAGAAACACGGTATAAAAGTAGATGCTAACAATACACGTACGCTCGTATCTATGAACACGCACA[C/T]
GCGCATCCTACTTCTATAAGCACCTCCAAAAAACTGGACTGACATATATTTTGAGGTTGACAAAATCACCATGGGCACCTCGTTGGTGATGAGTACGTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.40%	24.00%	6.94%	27.63%	NA
All Indica	2759	42.40%	6.80%	9.50%	41.32%	NA
All Japonica	1512	33.30%	56.90%	3.31%	6.48%	NA
Aus	269	87.40%	0.00%	1.86%	10.78%	NA
Indica I	595	36.50%	3.20%	9.75%	50.59%	NA
Indica II	465	18.10%	3.00%	18.92%	60.00%	NA
Indica III	913	64.70%	4.30%	4.49%	26.51%	NA
Indica Intermediate	786	35.20%	14.80%	9.54%	40.46%	NA
Temperate Japonica	767	35.20%	54.50%	4.17%	6.13%	NA
Tropical Japonica	504	23.20%	67.70%	1.79%	7.34%	NA
Japonica Intermediate	241	48.10%	42.30%	3.73%	5.81%	NA
VI/Aromatic	96	15.60%	68.80%	2.08%	13.54%	NA
Intermediate	90	40.00%	21.10%	10.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104927782	G -> A	LOC_Os11g09180.1	upstream_gene_variant ; 2143.0bp to feature; MODIFIER	silent_mutation	Average:63.037; most accessible tissue: Callus, score: 89.803	N	N	N	N
vg1104927782	G -> A	LOC_Os11g09190.1	upstream_gene_variant ; 4198.0bp to feature; MODIFIER	silent_mutation	Average:63.037; most accessible tissue: Callus, score: 89.803	N	N	N	N
vg1104927782	G -> A	LOC_Os11g09180.2	upstream_gene_variant ; 2143.0bp to feature; MODIFIER	silent_mutation	Average:63.037; most accessible tissue: Callus, score: 89.803	N	N	N	N
vg1104927782	G -> A	LOC_Os11g09170.1	downstream_gene_variant ; 4057.0bp to feature; MODIFIER	silent_mutation	Average:63.037; most accessible tissue: Callus, score: 89.803	N	N	N	N
vg1104927782	G -> A	LOC_Os11g09170.2	downstream_gene_variant ; 4057.0bp to feature; MODIFIER	silent_mutation	Average:63.037; most accessible tissue: Callus, score: 89.803	N	N	N	N
vg1104927782	G -> A	LOC_Os11g09180-LOC_Os11g09190	intergenic_region ; MODIFIER	silent_mutation	Average:63.037; most accessible tissue: Callus, score: 89.803	N	N	N	N
vg1104927782	G -> DEL	N	N	silent_mutation	Average:63.037; most accessible tissue: Callus, score: 89.803	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104927782	NA	2.76E-09	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	NA	7.56E-06	mr1046_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	4.42E-06	4.42E-06	mr1262_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	NA	8.55E-06	mr1345_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	2.60E-06	2.60E-06	mr1523_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	6.71E-06	6.71E-06	mr1537_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	NA	3.10E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	NA	8.00E-07	mr1646_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	5.05E-06	6.39E-07	mr1661_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	NA	2.11E-06	mr1713_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	NA	6.93E-08	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	NA	7.56E-07	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	NA	3.06E-06	mr1890_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	NA	2.72E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782	NA	6.99E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251