\
| Variant ID: vg1104927782 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4927782 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGACGTACTCATCACCAACGAGGTGCCCATGGTGATTTTGTCAACCTCAAAATATATGTCAGTCCAGTTTTTTGGAGGTGCTTATAGAAGTAGGATGCGC[G/A]
TGTGCGTGTTCATAGATACGAGCGTACGTGTATTGTTAGCATCTACTTTTATACCGTGTTTCTAATAAAAGGAAAATAATAATAATAATATTTACAGTAT
ATACTGTAAATATTATTATTATTATTTTCCTTTTATTAGAAACACGGTATAAAAGTAGATGCTAACAATACACGTACGCTCGTATCTATGAACACGCACA[C/T]
GCGCATCCTACTTCTATAAGCACCTCCAAAAAACTGGACTGACATATATTTTGAGGTTGACAAAATCACCATGGGCACCTCGTTGGTGATGAGTACGTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.40% | 24.00% | 6.94% | 27.63% | NA |
| All Indica | 2759 | 42.40% | 6.80% | 9.50% | 41.32% | NA |
| All Japonica | 1512 | 33.30% | 56.90% | 3.31% | 6.48% | NA |
| Aus | 269 | 87.40% | 0.00% | 1.86% | 10.78% | NA |
| Indica I | 595 | 36.50% | 3.20% | 9.75% | 50.59% | NA |
| Indica II | 465 | 18.10% | 3.00% | 18.92% | 60.00% | NA |
| Indica III | 913 | 64.70% | 4.30% | 4.49% | 26.51% | NA |
| Indica Intermediate | 786 | 35.20% | 14.80% | 9.54% | 40.46% | NA |
| Temperate Japonica | 767 | 35.20% | 54.50% | 4.17% | 6.13% | NA |
| Tropical Japonica | 504 | 23.20% | 67.70% | 1.79% | 7.34% | NA |
| Japonica Intermediate | 241 | 48.10% | 42.30% | 3.73% | 5.81% | NA |
| VI/Aromatic | 96 | 15.60% | 68.80% | 2.08% | 13.54% | NA |
| Intermediate | 90 | 40.00% | 21.10% | 10.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104927782 | G -> A | LOC_Os11g09180.1 | upstream_gene_variant ; 2143.0bp to feature; MODIFIER | silent_mutation | Average:63.037; most accessible tissue: Callus, score: 89.803 | N | N | N | N |
| vg1104927782 | G -> A | LOC_Os11g09190.1 | upstream_gene_variant ; 4198.0bp to feature; MODIFIER | silent_mutation | Average:63.037; most accessible tissue: Callus, score: 89.803 | N | N | N | N |
| vg1104927782 | G -> A | LOC_Os11g09180.2 | upstream_gene_variant ; 2143.0bp to feature; MODIFIER | silent_mutation | Average:63.037; most accessible tissue: Callus, score: 89.803 | N | N | N | N |
| vg1104927782 | G -> A | LOC_Os11g09170.1 | downstream_gene_variant ; 4057.0bp to feature; MODIFIER | silent_mutation | Average:63.037; most accessible tissue: Callus, score: 89.803 | N | N | N | N |
| vg1104927782 | G -> A | LOC_Os11g09170.2 | downstream_gene_variant ; 4057.0bp to feature; MODIFIER | silent_mutation | Average:63.037; most accessible tissue: Callus, score: 89.803 | N | N | N | N |
| vg1104927782 | G -> A | LOC_Os11g09180-LOC_Os11g09190 | intergenic_region ; MODIFIER | silent_mutation | Average:63.037; most accessible tissue: Callus, score: 89.803 | N | N | N | N |
| vg1104927782 | G -> DEL | N | N | silent_mutation | Average:63.037; most accessible tissue: Callus, score: 89.803 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104927782 | NA | 2.76E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | NA | 7.56E-06 | mr1046_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | 4.42E-06 | 4.42E-06 | mr1262_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | NA | 8.55E-06 | mr1345_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | 2.60E-06 | 2.60E-06 | mr1523_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | 6.71E-06 | 6.71E-06 | mr1537_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | NA | 3.10E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | NA | 8.00E-07 | mr1646_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | 5.05E-06 | 6.39E-07 | mr1661_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | NA | 2.11E-06 | mr1713_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | NA | 6.93E-08 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | NA | 7.56E-07 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | NA | 3.06E-06 | mr1890_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | NA | 2.72E-06 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104927782 | NA | 6.99E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |