\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104927782:

Variant ID: vg1104927782 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4927782
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGACGTACTCATCACCAACGAGGTGCCCATGGTGATTTTGTCAACCTCAAAATATATGTCAGTCCAGTTTTTTGGAGGTGCTTATAGAAGTAGGATGCGC[G/A]
TGTGCGTGTTCATAGATACGAGCGTACGTGTATTGTTAGCATCTACTTTTATACCGTGTTTCTAATAAAAGGAAAATAATAATAATAATATTTACAGTAT

Reverse complement sequence

ATACTGTAAATATTATTATTATTATTTTCCTTTTATTAGAAACACGGTATAAAAGTAGATGCTAACAATACACGTACGCTCGTATCTATGAACACGCACA[C/T]
GCGCATCCTACTTCTATAAGCACCTCCAAAAAACTGGACTGACATATATTTTGAGGTTGACAAAATCACCATGGGCACCTCGTTGGTGATGAGTACGTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.40% 24.00% 6.94% 27.63% NA
All Indica  2759 42.40% 6.80% 9.50% 41.32% NA
All Japonica  1512 33.30% 56.90% 3.31% 6.48% NA
Aus  269 87.40% 0.00% 1.86% 10.78% NA
Indica I  595 36.50% 3.20% 9.75% 50.59% NA
Indica II  465 18.10% 3.00% 18.92% 60.00% NA
Indica III  913 64.70% 4.30% 4.49% 26.51% NA
Indica Intermediate  786 35.20% 14.80% 9.54% 40.46% NA
Temperate Japonica  767 35.20% 54.50% 4.17% 6.13% NA
Tropical Japonica  504 23.20% 67.70% 1.79% 7.34% NA
Japonica Intermediate  241 48.10% 42.30% 3.73% 5.81% NA
VI/Aromatic  96 15.60% 68.80% 2.08% 13.54% NA
Intermediate  90 40.00% 21.10% 10.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104927782 G -> A LOC_Os11g09180.1 upstream_gene_variant ; 2143.0bp to feature; MODIFIER silent_mutation Average:63.037; most accessible tissue: Callus, score: 89.803 N N N N
vg1104927782 G -> A LOC_Os11g09190.1 upstream_gene_variant ; 4198.0bp to feature; MODIFIER silent_mutation Average:63.037; most accessible tissue: Callus, score: 89.803 N N N N
vg1104927782 G -> A LOC_Os11g09180.2 upstream_gene_variant ; 2143.0bp to feature; MODIFIER silent_mutation Average:63.037; most accessible tissue: Callus, score: 89.803 N N N N
vg1104927782 G -> A LOC_Os11g09170.1 downstream_gene_variant ; 4057.0bp to feature; MODIFIER silent_mutation Average:63.037; most accessible tissue: Callus, score: 89.803 N N N N
vg1104927782 G -> A LOC_Os11g09170.2 downstream_gene_variant ; 4057.0bp to feature; MODIFIER silent_mutation Average:63.037; most accessible tissue: Callus, score: 89.803 N N N N
vg1104927782 G -> A LOC_Os11g09180-LOC_Os11g09190 intergenic_region ; MODIFIER silent_mutation Average:63.037; most accessible tissue: Callus, score: 89.803 N N N N
vg1104927782 G -> DEL N N silent_mutation Average:63.037; most accessible tissue: Callus, score: 89.803 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104927782 NA 2.76E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 NA 7.56E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 4.42E-06 4.42E-06 mr1262_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 NA 8.55E-06 mr1345_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 2.60E-06 2.60E-06 mr1523_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 6.71E-06 6.71E-06 mr1537_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 NA 3.10E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 NA 8.00E-07 mr1646_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 5.05E-06 6.39E-07 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 NA 2.11E-06 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 NA 6.93E-08 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 NA 7.56E-07 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 NA 3.06E-06 mr1890_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 NA 2.72E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104927782 NA 6.99E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251