\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104807637:

Variant ID: vg1104807637 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 4807637
Reference Allele: CAGAlternative Allele: GAG,C
Primary Allele: CAGSecondary Allele: GAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAATACAAAACCAAAACTAAAAAACAAAAACAAATTTGCTCATCCAAATTGCACACAAAGCAGCCACAACACATGAGCAGGTTGATGAGATCACACACA[CAG/GAG,C]
AGAGAGTGAGATGACGTCAGCCCAGAACGCTGTAAAGATCGCCATTGTTGCCGTAGAAGCCATCGCCGCCCTTGTCCTTGGTGCTCTTCCTCTTGGAGAA

Reverse complement sequence

TTCTCCAAGAGGAAGAGCACCAAGGACAAGGGCGGCGATGGCTTCTACGGCAACAATGGCGATCTTTACAGCGTTCTGGGCTGACGTCATCTCACTCTCT[CTG/CTC,G]
TGTGTGTGATCTCATCAACCTGCTCATGTGTTGTGGCTGCTTTGTGTGCAATTTGGATGAGCAAATTTGTTTTTGTTTTTTAGTTTTGGTTTTGTATTTC

Allele Frequencies:

Populations Population SizeFrequency of CAG(primary allele) Frequency of GAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 20.30% 0.08% 0.00% C: 0.06%
All Indica  2759 70.90% 29.00% 0.11% 0.00% C: 0.04%
All Japonica  1512 95.80% 4.20% 0.07% 0.00% NA
Aus  269 73.60% 26.40% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 28.40% 71.60% 0.00% 0.00% NA
Indica III  913 72.80% 26.90% 0.22% 0.00% NA
Indica Intermediate  786 72.60% 27.10% 0.13% 0.00% C: 0.13%
Temperate Japonica  767 99.20% 0.70% 0.13% 0.00% NA
Tropical Japonica  504 90.70% 9.30% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 0.00% 0.00% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104807637 CAG -> C LOC_Os11g09040.1 3_prime_UTR_variant ; 17.0bp to feature; MODIFIER silent_mutation Average:63.379; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg1104807637 CAG -> C LOC_Os11g09030.1 upstream_gene_variant ; 858.0bp to feature; MODIFIER silent_mutation Average:63.379; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg1104807637 CAG -> C LOC_Os11g09050.1 downstream_gene_variant ; 2633.0bp to feature; MODIFIER silent_mutation Average:63.379; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg1104807637 CAG -> GAG LOC_Os11g09040.1 3_prime_UTR_variant ; 19.0bp to feature; MODIFIER silent_mutation Average:63.379; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg1104807637 CAG -> GAG LOC_Os11g09030.1 upstream_gene_variant ; 857.0bp to feature; MODIFIER silent_mutation Average:63.379; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg1104807637 CAG -> GAG LOC_Os11g09050.1 downstream_gene_variant ; 2634.0bp to feature; MODIFIER silent_mutation Average:63.379; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104807637 NA 3.30E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104807637 NA 3.60E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 2.60E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 3.69E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 4.79E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 7.44E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 5.36E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 6.09E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 1.99E-06 1.99E-06 mr1452 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 4.67E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 3.48E-06 3.48E-06 mr1513 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 6.67E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 4.12E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 2.48E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 9.73E-06 mr1632 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 2.66E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 9.07E-08 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 3.62E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 1.67E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 2.02E-09 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 3.16E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 1.39E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 1.48E-10 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 2.59E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 3.41E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 1.32E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104807637 NA 9.90E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251