\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104752147:

Variant ID: vg1104752147 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4752147
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATGGGAACCCATCCCTGTCACCGGCCAGCTAGACCCATATGTACTGCACTGCAATCAGTCACCAAGAGCTCTTTCTATTTTATATTATAAATCGTTTT[G/C,A]
AATTTTCTTTTTTCAATTTTTGTAAAAGTTTAATCAAATTTATAGGAAAATATAATCATATTTTACACTATCAATTTAGTTTCATTACATCTACATTGAA

Reverse complement sequence

TTCAATGTAGATGTAATGAAACTAAATTGATAGTGTAAAATATGATTATATTTTCCTATAAATTTGATTAAACTTTTACAAAAATTGAAAAAAGAAAATT[C/G,T]
AAAACGATTTATAATATAAAATAGAAAGAGCTCTTGGTGACTGATTGCAGTGCAGTACATATGGGTCTAGCTGGCCGGTGACAGGGATGGGTTCCCATGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 21.40% 2.45% 1.90% A: 8.63%
All Indica  2759 51.20% 36.00% 2.25% 3.12% A: 7.43%
All Japonica  1512 85.20% 0.30% 2.12% 0.07% A: 12.37%
Aus  269 95.50% 1.50% 1.49% 1.12% A: 0.37%
Indica I  595 55.00% 37.00% 2.69% 2.35% A: 3.03%
Indica II  465 71.40% 15.30% 4.95% 5.38% A: 3.01%
Indica III  913 41.50% 49.10% 0.55% 2.08% A: 6.79%
Indica Intermediate  786 47.60% 32.40% 2.29% 3.56% A: 14.12%
Temperate Japonica  767 85.40% 0.40% 3.78% 0.00% A: 10.43%
Tropical Japonica  504 93.70% 0.20% 0.00% 0.20% A: 5.95%
Japonica Intermediate  241 66.80% 0.00% 1.24% 0.00% A: 31.95%
VI/Aromatic  96 78.10% 0.00% 12.50% 0.00% A: 9.38%
Intermediate  90 77.80% 8.90% 6.67% 0.00% A: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104752147 G -> A LOC_Os11g08950-LOC_Os11g08970 intergenic_region ; MODIFIER silent_mutation Average:67.694; most accessible tissue: Minghui63 root, score: 95.915 N N N N
vg1104752147 G -> DEL N N silent_mutation Average:67.694; most accessible tissue: Minghui63 root, score: 95.915 N N N N
vg1104752147 G -> C LOC_Os11g08950-LOC_Os11g08970 intergenic_region ; MODIFIER silent_mutation Average:67.694; most accessible tissue: Minghui63 root, score: 95.915 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1104752147 G A 0.02 0.02 0.01 0.03 0.03 0.04
vg1104752147 G C 0.0 0.14 0.06 -0.01 0.03 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104752147 NA 8.35E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104752147 3.36E-07 NA mr1336 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251