\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104746758:

Variant ID: vg1104746758 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4746758
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.07, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GGATATTTTGATCCTTTCACCTATCTACTATTGTTATATTGGGATTCTAGGAATTTATTTTTTTTATAAGATAGAGTGAGCTAGTATGTTTGAAGAAAAG[C/A]
TCAATAGAAGATTATAGTAATATACTACAAATAAATGAAATGTATCTGTTTTGGTTTTGACCTTGCCATCTATTGTACATGTTATGTATCTTGCTCTTTT

Reverse complement sequence

AAAAGAGCAAGATACATAACATGTACAATAGATGGCAAGGTCAAAACCAAAACAGATACATTTCATTTATTTGTAGTATATTACTATAATCTTCTATTGA[G/T]
CTTTTCTTCAAACATACTAGCTCACTCTATCTTATAAAAAAAATAAATTCCTAGAATCCCAATATAACAATAGTAGATAGGTGAAAGGATCAAAATATCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 22.30% 0.53% 22.03% NA
All Indica  2759 48.50% 14.20% 0.72% 36.57% NA
All Japonica  1512 74.80% 24.90% 0.00% 0.26% NA
Aus  269 26.00% 71.70% 0.74% 1.49% NA
Indica I  595 19.80% 41.80% 1.51% 36.81% NA
Indica II  465 79.80% 3.70% 0.22% 16.34% NA
Indica III  913 44.20% 6.40% 0.22% 49.18% NA
Indica Intermediate  786 56.50% 8.80% 1.02% 33.72% NA
Temperate Japonica  767 71.10% 28.70% 0.00% 0.26% NA
Tropical Japonica  504 90.70% 9.10% 0.00% 0.20% NA
Japonica Intermediate  241 53.50% 46.10% 0.00% 0.41% NA
VI/Aromatic  96 8.30% 76.00% 1.04% 14.58% NA
Intermediate  90 65.60% 21.10% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104746758 C -> A LOC_Os11g08950-LOC_Os11g08970 intergenic_region ; MODIFIER silent_mutation Average:35.838; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg1104746758 C -> DEL N N silent_mutation Average:35.838; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104746758 NA 3.88E-08 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 2.53E-07 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 6.90E-06 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 2.88E-09 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 1.67E-11 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 4.42E-06 mr1274 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 4.82E-09 mr1347 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 1.18E-06 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 4.08E-06 4.08E-06 mr1487 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 9.65E-06 2.53E-08 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 6.85E-08 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 7.70E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 7.08E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 1.87E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 8.12E-07 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 6.19E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104746758 NA 2.14E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251