Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104743483:

Variant ID: vg1104743483 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4743483
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAGTAACTTACGTATATAATAAAAGTAATTTACAAATATAAATATTTTTTCATCGTAATATAATCATGTAAGATCTTGTTGTGAAGATTTAATTGTAA[C/T]
GAACATAACGGTGTAATTGGATTGTAGATCGAATAAGTAATTTGAGAGAAAACTTTATTTGAAGAGAAAAAAAGGCATACATGTATATCTCAGTCCTTCC

Reverse complement sequence

GGAAGGACTGAGATATACATGTATGCCTTTTTTTCTCTTCAAATAAAGTTTTCTCTCAAATTACTTATTCGATCTACAATCCAATTACACCGTTATGTTC[G/A]
TTACAATTAAATCTTCACAACAAGATCTTACATGATTATATTACGATGAAAAAATATTTATATTTGTAAATTACTTTTATTATATACGTAAGTTACTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.00%	20.70%	3.28%	1.06%	NA
All Indica	2759	58.70%	34.30%	5.22%	1.81%	NA
All Japonica	1512	99.40%	0.40%	0.20%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	56.30%	31.60%	9.08%	3.03%	NA
Indica II	465	83.20%	13.10%	2.37%	1.29%	NA
Indica III	913	51.70%	43.20%	3.61%	1.53%	NA
Indica Intermediate	786	54.10%	38.50%	5.85%	1.53%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	0.40%	1.24%	0.00%	NA
VI/Aromatic	96	84.40%	8.30%	7.29%	0.00%	NA
Intermediate	90	86.70%	12.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104743483	C -> T	LOC_Os11g08950.1	upstream_gene_variant ; 4686.0bp to feature; MODIFIER	silent_mutation	Average:43.307; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1104743483	C -> T	LOC_Os11g08950-LOC_Os11g08970	intergenic_region ; MODIFIER	silent_mutation	Average:43.307; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1104743483	C -> DEL	N	N	silent_mutation	Average:43.307; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104743483	2.80E-06	2.80E-06	mr1337	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104743483	NA	1.14E-06	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104743483	NA	8.63E-06	mr1500	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104743483	2.38E-07	2.38E-07	mr1524	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104743483	NA	8.87E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104743483	NA	5.64E-06	mr1549	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104743483	NA	1.76E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251