\
| Variant ID: vg1104740558 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4740558 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.05, others allele: 0.00, population size: 38. )
CTGTGGACCAGACACGGTCATGTTCAGTTGGCAGTTGGCTACTTCGATCTCGTAGTAGTATATGTTTTTTTCTATCCGGATAAAAATTTATACCATGTTA[C/A]
ATCGAATGTTTGGATACATGCATAGAGGATTAAATATAAATGAAAAAATAACTAATTACATAAACTGTGTGTAAATTGCGAGACGAATCTTTTAAGCCTA
TAGGCTTAAAAGATTCGTCTCGCAATTTACACACAGTTTATGTAATTAGTTATTTTTTCATTTATATTTAATCCTCTATGCATGTATCCAAACATTCGAT[G/T]
TAACATGGTATAAATTTTTATCCGGATAGAAAAAAACATATACTACTACGAGATCGAAGTAGCCAACTGCCAACTGAACATGACCGTGTCTGGTCCACAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.20% | 15.60% | 0.78% | 50.42% | NA |
| All Indica | 2759 | 6.70% | 14.20% | 0.33% | 78.72% | NA |
| All Japonica | 1512 | 84.30% | 8.60% | 1.79% | 5.36% | NA |
| Aus | 269 | 0.00% | 71.00% | 0.00% | 29.00% | NA |
| Indica I | 595 | 1.80% | 41.70% | 0.84% | 55.63% | NA |
| Indica II | 465 | 4.30% | 3.90% | 0.22% | 91.61% | NA |
| Indica III | 913 | 9.60% | 6.10% | 0.11% | 84.12% | NA |
| Indica Intermediate | 786 | 8.50% | 8.90% | 0.25% | 82.32% | NA |
| Temperate Japonica | 767 | 85.30% | 10.30% | 3.39% | 1.04% | NA |
| Tropical Japonica | 504 | 82.50% | 4.40% | 0.00% | 13.10% | NA |
| Japonica Intermediate | 241 | 84.60% | 12.00% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 70.80% | 12.50% | 0.00% | 16.67% | NA |
| Intermediate | 90 | 45.60% | 13.30% | 1.11% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104740558 | C -> A | LOC_Os11g08950.1 | upstream_gene_variant ; 1761.0bp to feature; MODIFIER | silent_mutation | Average:70.19; most accessible tissue: Minghui63 root, score: 86.792 | N | N | N | N |
| vg1104740558 | C -> A | LOC_Os11g08950-LOC_Os11g08970 | intergenic_region ; MODIFIER | silent_mutation | Average:70.19; most accessible tissue: Minghui63 root, score: 86.792 | N | N | N | N |
| vg1104740558 | C -> DEL | N | N | silent_mutation | Average:70.19; most accessible tissue: Minghui63 root, score: 86.792 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104740558 | 1.96E-08 | 6.31E-19 | Awn_length | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1104740558 | NA | 9.92E-09 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 1.76E-07 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 4.27E-07 | mr1201 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 6.64E-07 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 3.73E-06 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 2.65E-11 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 5.83E-12 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 3.86E-06 | mr1274 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 4.23E-06 | mr1406 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | 8.69E-06 | 8.69E-06 | mr1487 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | 1.69E-06 | 7.12E-09 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 1.47E-07 | mr1933 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 5.14E-07 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 5.07E-07 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 1.21E-08 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 1.04E-07 | mr1274_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104740558 | NA | 8.38E-07 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |