\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104739877:

Variant ID: vg1104739877 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4739877
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAAACTCTCTCCCCGGTGATTTGGTAAAAAAAATTCGGGTGAGCTGATTCTATCACAGAAAATCTAACCAGTTGAGTTAGGGGGTGTTTGGGAGAGAG[G/T]
GGCTAAACTTTAGCCCCACTCAAACACCCCCTTAAGCTCGTTAATAATGGGTAGTTACCGTGATTAATCTAATCACGGTGCCACTTGGCTAATCGTCTCG

Reverse complement sequence

CGAGACGATTAGCCAAGTGGCACCGTGATTAGATTAATCACGGTAACTACCCATTATTAACGAGCTTAAGGGGGTGTTTGAGTGGGGCTAAAGTTTAGCC[C/A]
CTCTCTCCCAAACACCCCCTAACTCAACTGGTTAGATTTTCTGTGATAGAATCAGCTCACCCGAATTTTTTTTACCAAATCACCGGGGAGAGAGTTTTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 4.40% 18.03% 21.69% NA
All Indica  2759 30.30% 7.50% 26.64% 35.59% NA
All Japonica  1512 96.20% 0.00% 2.65% 1.19% NA
Aus  269 76.20% 0.00% 16.73% 7.06% NA
Indica I  595 10.80% 31.30% 24.54% 33.45% NA
Indica II  465 33.50% 0.90% 44.73% 20.86% NA
Indica III  913 32.60% 0.10% 21.36% 45.89% NA
Indica Intermediate  786 40.30% 2.00% 23.66% 33.97% NA
Temperate Japonica  767 99.20% 0.00% 0.26% 0.52% NA
Tropical Japonica  504 91.10% 0.00% 6.35% 2.58% NA
Japonica Intermediate  241 97.10% 0.00% 2.49% 0.41% NA
VI/Aromatic  96 85.40% 0.00% 14.58% 0.00% NA
Intermediate  90 71.10% 2.20% 20.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104739877 G -> T LOC_Os11g08950.1 upstream_gene_variant ; 1080.0bp to feature; MODIFIER silent_mutation Average:90.782; most accessible tissue: Zhenshan97 root, score: 97.61 N N N N
vg1104739877 G -> T LOC_Os11g08950-LOC_Os11g08970 intergenic_region ; MODIFIER silent_mutation Average:90.782; most accessible tissue: Zhenshan97 root, score: 97.61 N N N N
vg1104739877 G -> DEL N N silent_mutation Average:90.782; most accessible tissue: Zhenshan97 root, score: 97.61 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1104739877 G T 0.09 0.03 0.0 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104739877 NA 5.41E-10 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 1.83E-09 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 4.31E-06 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 4.97E-07 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 1.89E-14 mr1274 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 8.61E-06 6.41E-13 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 6.53E-06 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 4.25E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 1.46E-06 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 1.71E-08 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 1.47E-07 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 4.52E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 1.54E-08 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 3.02E-08 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 4.72E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 1.42E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 3.19E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104739877 NA 1.38E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251