\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104738557:

Variant ID: vg1104738557 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4738557
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGAAAAAGGAAAAAAAAAATCCCCAAAAAAAGATAAATCCCCAAAAAAAGATGAGCAAGCGAGGCACAAGGAAATGGCAAGAGATTAGAAGCAGCGAG[C/A]
GAGACTCGCACCGGCGGCGGCGGCGGCGGCGACGTGGAGGGCGACGATGCGGTCCCCGGCATTGGCGACCTTGACGAGCGCCCACGTCAGCAGCTCGCGG

Reverse complement sequence

CCGCGAGCTGCTGACGTGGGCGCTCGTCAAGGTCGCCAATGCCGGGGACCGCATCGTCGCCCTCCACGTCGCCGCCGCCGCCGCCGCCGGTGCGAGTCTC[G/T]
CTCGCTGCTTCTAATCTCTTGCCATTTCCTTGTGCCTCGCTTGCTCATCTTTTTTTGGGGATTTATCTTTTTTTGGGGATTTTTTTTTTCCTTTTTCTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 17.50% 0.11% 0.00% NA
All Indica  2759 86.40% 13.40% 0.11% 0.00% NA
All Japonica  1512 83.70% 16.10% 0.13% 0.00% NA
Aus  269 29.40% 70.60% 0.00% 0.00% NA
Indica I  595 59.20% 40.80% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 94.10% 5.60% 0.33% 0.00% NA
Indica Intermediate  786 92.10% 7.90% 0.00% 0.00% NA
Temperate Japonica  767 76.00% 23.70% 0.26% 0.00% NA
Tropical Japonica  504 95.40% 4.60% 0.00% 0.00% NA
Japonica Intermediate  241 83.80% 16.20% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104738557 C -> A LOC_Os11g08940.1 downstream_gene_variant ; 4513.0bp to feature; MODIFIER silent_mutation Average:92.351; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N
vg1104738557 C -> A LOC_Os11g08950.1 intron_variant ; MODIFIER silent_mutation Average:92.351; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1104738557 C A -0.01 -0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104738557 NA 3.04E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104738557 NA 2.44E-08 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 5.40E-08 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 1.02E-06 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 1.65E-06 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 1.38E-11 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 2.54E-07 1.89E-13 mr1274 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 9.27E-06 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 1.46E-06 5.74E-09 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 4.46E-06 1.38E-08 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 1.54E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 1.74E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 2.34E-09 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 3.14E-07 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 2.08E-06 mr1274_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104738557 NA 2.19E-07 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251