\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104729857:

Variant ID: vg1104729857 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4729857
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AATCTGAGGACGGTGGCCGGTGGACAAGGCGTCGACAGATATGTGGCTAGCCGCGATAGACCAGGGGCATCGATAGGAGGTGGAGGACGGCGTCATGGCC[G/A]
TGGCAGGCAGTGGGCAGCAGTGTGATCGGGAGTGCTCACCGTCGGGGACGCGTCAACACCGAGCGGCCACCGGCCATCTCTCCTCTCTGCTCCACACACT

Reverse complement sequence

AGTGTGTGGAGCAGAGAGGAGAGATGGCCGGTGGCCGCTCGGTGTTGACGCGTCCCCGACGGTGAGCACTCCCGATCACACTGCTGCCCACTGCCTGCCA[C/T]
GGCCATGACGCCGTCCTCCACCTCCTATCGATGCCCCTGGTCTATCGCGGCTAGCCACATATCTGTCGACGCCTTGTCCACCGGCCACCGTCCTCAGATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 21.50% 0.11% 0.06% NA
All Indica  2759 69.10% 30.70% 0.11% 0.11% NA
All Japonica  1512 95.00% 5.00% 0.00% 0.00% NA
Aus  269 72.50% 27.50% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 26.90% 72.50% 0.22% 0.43% NA
Indica III  913 69.10% 30.80% 0.11% 0.00% NA
Indica Intermediate  786 71.80% 28.00% 0.13% 0.13% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 86.90% 13.10% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104729857 G -> A LOC_Os11g08930.1 upstream_gene_variant ; 4731.0bp to feature; MODIFIER silent_mutation Average:85.081; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg1104729857 G -> A LOC_Os11g08940.1 upstream_gene_variant ; 2162.0bp to feature; MODIFIER silent_mutation Average:85.081; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg1104729857 G -> A LOC_Os11g08930.2 upstream_gene_variant ; 4731.0bp to feature; MODIFIER silent_mutation Average:85.081; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg1104729857 G -> A LOC_Os11g08930-LOC_Os11g08940 intergenic_region ; MODIFIER silent_mutation Average:85.081; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg1104729857 G -> DEL N N silent_mutation Average:85.081; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1104729857 G A -0.01 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104729857 NA 1.23E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104729857 NA 4.66E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 1.13E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 5.51E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 1.43E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 3.61E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 8.19E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 1.88E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 1.31E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 3.56E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 6.03E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 3.03E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 2.32E-06 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 1.83E-09 mr1919 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 8.00E-07 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 3.94E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 5.15E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 1.53E-09 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 6.68E-07 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 8.80E-11 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 4.99E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 3.53E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104729857 NA 7.36E-11 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251