\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104701934:

Variant ID: vg1104701934 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4701934
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTGATGAAGTGATCAACGGTGAAACGGTTGGCCTCCGCCTCGGTGATCACCCGGACGCCCTTCCACTTCACACGGTCGGCCGTCTCTGCCCCAGCGCC[T/C]
TTGTTGCCATACTCCAGGTACTCCACTGTCCTGGTCGTCTCCTCCACAGGTGTTGCCTTGTTCCAGTGAACCCAGCCGTCAGGGTTGATGATGTCGCTCA

Reverse complement sequence

TGAGCGACATCATCAACCCTGACGGCTGGGTTCACTGGAACAAGGCAACACCTGTGGAGGAGACGACCAGGACAGTGGAGTACCTGGAGTATGGCAACAA[A/G]
GGCGCTGGGGCAGAGACGGCCGACCGTGTGAAGTGGAAGGGCGTCCGGGTGATCACCGAGGCGGAGGCCAACCGTTTCACCGTTGATCACTTCATCAACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.50% 21.00% 0.91% 29.58% NA
All Indica  2759 46.00% 19.00% 0.76% 34.22% NA
All Japonica  1512 61.50% 16.50% 0.93% 21.03% NA
Aus  269 2.20% 71.00% 1.49% 25.28% NA
Indica I  595 46.10% 51.80% 0.50% 1.68% NA
Indica II  465 21.30% 4.70% 2.15% 71.83% NA
Indica III  913 52.80% 9.30% 0.33% 37.57% NA
Indica Intermediate  786 52.80% 13.90% 0.64% 32.70% NA
Temperate Japonica  767 71.60% 24.10% 0.39% 3.91% NA
Tropical Japonica  504 50.20% 4.80% 1.98% 43.06% NA
Japonica Intermediate  241 53.10% 17.00% 0.41% 29.46% NA
VI/Aromatic  96 42.70% 13.50% 4.17% 39.58% NA
Intermediate  90 50.00% 16.70% 0.00% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104701934 T -> DEL LOC_Os11g08870.1 N frameshift_variant Average:30.061; most accessible tissue: Zhenshan97 flower, score: 74.459 N N N N
vg1104701934 T -> C LOC_Os11g08870.1 synonymous_variant ; p.Lys329Lys; LOW stop_gained Average:30.061; most accessible tissue: Zhenshan97 flower, score: 74.459 N N N N
vg1104701934 T -> C LOC_Os11g08870.1 synonymous_variant ; p.Lys329Lys; LOW nonsynonymous_codon ; K329W Average:30.061; most accessible tissue: Zhenshan97 flower, score: 74.459 benign 0.159 TOLERATED 0.20

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104701934 NA 9.61E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 NA 2.52E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 NA 3.65E-07 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 NA 1.71E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 1.70E-06 1.70E-06 mr1337 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 NA 1.24E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 NA 2.27E-06 mr1500 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 1.99E-06 1.99E-06 mr1524 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 NA 1.09E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 NA 6.05E-06 mr1549 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 NA 8.58E-06 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104701934 NA 8.12E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251