\
| Variant ID: vg1104701934 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4701934 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 86. )
CGTTGATGAAGTGATCAACGGTGAAACGGTTGGCCTCCGCCTCGGTGATCACCCGGACGCCCTTCCACTTCACACGGTCGGCCGTCTCTGCCCCAGCGCC[T/C]
TTGTTGCCATACTCCAGGTACTCCACTGTCCTGGTCGTCTCCTCCACAGGTGTTGCCTTGTTCCAGTGAACCCAGCCGTCAGGGTTGATGATGTCGCTCA
TGAGCGACATCATCAACCCTGACGGCTGGGTTCACTGGAACAAGGCAACACCTGTGGAGGAGACGACCAGGACAGTGGAGTACCTGGAGTATGGCAACAA[A/G]
GGCGCTGGGGCAGAGACGGCCGACCGTGTGAAGTGGAAGGGCGTCCGGGTGATCACCGAGGCGGAGGCCAACCGTTTCACCGTTGATCACTTCATCAACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.50% | 21.00% | 0.91% | 29.58% | NA |
| All Indica | 2759 | 46.00% | 19.00% | 0.76% | 34.22% | NA |
| All Japonica | 1512 | 61.50% | 16.50% | 0.93% | 21.03% | NA |
| Aus | 269 | 2.20% | 71.00% | 1.49% | 25.28% | NA |
| Indica I | 595 | 46.10% | 51.80% | 0.50% | 1.68% | NA |
| Indica II | 465 | 21.30% | 4.70% | 2.15% | 71.83% | NA |
| Indica III | 913 | 52.80% | 9.30% | 0.33% | 37.57% | NA |
| Indica Intermediate | 786 | 52.80% | 13.90% | 0.64% | 32.70% | NA |
| Temperate Japonica | 767 | 71.60% | 24.10% | 0.39% | 3.91% | NA |
| Tropical Japonica | 504 | 50.20% | 4.80% | 1.98% | 43.06% | NA |
| Japonica Intermediate | 241 | 53.10% | 17.00% | 0.41% | 29.46% | NA |
| VI/Aromatic | 96 | 42.70% | 13.50% | 4.17% | 39.58% | NA |
| Intermediate | 90 | 50.00% | 16.70% | 0.00% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104701934 | T -> DEL | LOC_Os11g08870.1 | N | frameshift_variant | Average:30.061; most accessible tissue: Zhenshan97 flower, score: 74.459 | N | N | N | N |
| vg1104701934 | T -> C | LOC_Os11g08870.1 | synonymous_variant ; p.Lys329Lys; LOW | stop_gained | Average:30.061; most accessible tissue: Zhenshan97 flower, score: 74.459 | N | N | N | N |
| vg1104701934 | T -> C | LOC_Os11g08870.1 | synonymous_variant ; p.Lys329Lys; LOW | nonsynonymous_codon ; K329W | Average:30.061; most accessible tissue: Zhenshan97 flower, score: 74.459 | benign |
0.159 |
TOLERATED | 0.20 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104701934 | NA | 9.61E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | NA | 2.52E-07 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | NA | 3.65E-07 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | NA | 1.71E-06 | mr1280 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | 1.70E-06 | 1.70E-06 | mr1337 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | NA | 1.24E-07 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | NA | 2.27E-06 | mr1500 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | 1.99E-06 | 1.99E-06 | mr1524 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | NA | 1.09E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | NA | 6.05E-06 | mr1549 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | NA | 8.58E-06 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104701934 | NA | 8.12E-08 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |