\
| Variant ID: vg1104609253 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4609253 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, T: 0.01, others allele: 0.00, population size: 108. )
CCACTGGCCCTATCAGGCAATATAATGGAGTCCTCCAGGGGTTGATGTTTAACGTGATGGCCTTCAACGTTGAATCATTCACAAGCGAAACATCATATTT[A/G]
CAAATTAAAAATAATTTATGAATAAAACTTTTATATACATGTTCTTAGCGATTTAAAACCATAAGGCTGAAAAATGTACTTCAATAAAAAGAAAAGCTCA
TGAGCTTTTCTTTTTATTGAAGTACATTTTTCAGCCTTATGGTTTTAAATCGCTAAGAACATGTATATAAAAGTTTTATTCATAAATTATTTTTAATTTG[T/C]
AAATATGATGTTTCGCTTGTGAATGATTCAACGTTGAAGGCCATCACGTTAAACATCAACCCCTGGAGGACTCCATTATATTGCCTGATAGGGCCAGTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 28.40% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 53.00% | 46.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.20% | 54.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 81.50% | 18.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 48.10% | 51.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 47.70% | 52.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104609253 | A -> G | LOC_Os11g08660.1 | upstream_gene_variant ; 4903.0bp to feature; MODIFIER | silent_mutation | Average:56.536; most accessible tissue: Callus, score: 91.421 | N | N | N | N |
| vg1104609253 | A -> G | LOC_Os11g08650.1 | downstream_gene_variant ; 2771.0bp to feature; MODIFIER | silent_mutation | Average:56.536; most accessible tissue: Callus, score: 91.421 | N | N | N | N |
| vg1104609253 | A -> G | LOC_Os11g08640-LOC_Os11g08650 | intergenic_region ; MODIFIER | silent_mutation | Average:56.536; most accessible tissue: Callus, score: 91.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104609253 | NA | 5.38E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 1.40E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 1.53E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 2.37E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 4.61E-06 | mr1228 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | 5.47E-06 | 5.47E-06 | mr1337 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 4.43E-06 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 1.65E-08 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 1.22E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 3.80E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | 5.76E-06 | 5.76E-06 | mr1524 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 7.07E-07 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | 4.30E-06 | 4.77E-08 | mr1549 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 7.60E-06 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 1.94E-06 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 4.49E-11 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 7.93E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104609253 | NA | 7.46E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |