Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104591250:

Variant ID: vg1104591250 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4591250
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, G: 0.49, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ACTCTTTTGTAAGCTTTGTACTTTTATTAGAATACTCTTCTATATACATTTATGGTATTGAAATACTTTCTGAGTATACGAGTATCTACTTTACATTATG[T/G]
TCATGTTATACTGAATATACGGCTAGCTTATCTGGGAGATGCTTTGATGCGGGTATAATGTTTGCTTATGCAATTAATCTATGTCATGACGATTATATTA

Reverse complement sequence

TAATATAATCGTCATGACATAGATTAATTGCATAAGCAAACATTATACCCGCATCAAAGCATCTCCCAGATAAGCTAGCCGTATATTCAGTATAACATGA[A/C]
CATAATGTAAAGTAGATACTCGTATACTCAGAAAGTATTTCAATACCATAAATGTATATAGAAGAGTATTCTAATAAAAGTACAAAGCTTACAAAAGAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.90%	19.20%	0.89%	0.00%	NA
All Indica	2759	88.20%	10.80%	1.01%	0.00%	NA
All Japonica	1512	72.00%	27.90%	0.13%	0.00%	NA
Aus	269	35.70%	60.20%	4.09%	0.00%	NA
Indica I	595	63.40%	33.30%	3.36%	0.00%	NA
Indica II	465	97.20%	2.60%	0.22%	0.00%	NA
Indica III	913	95.40%	4.50%	0.11%	0.00%	NA
Indica Intermediate	786	93.40%	5.90%	0.76%	0.00%	NA
Temperate Japonica	767	54.80%	45.10%	0.13%	0.00%	NA
Tropical Japonica	504	95.00%	5.00%	0.00%	0.00%	NA
Japonica Intermediate	241	78.40%	21.20%	0.41%	0.00%	NA
VI/Aromatic	96	82.30%	16.70%	1.04%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104591250	T -> G	LOC_Os11g08630.1	upstream_gene_variant ; 1098.0bp to feature; MODIFIER	silent_mutation	Average:42.642; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N
vg1104591250	T -> G	LOC_Os11g08620.1	downstream_gene_variant ; 1897.0bp to feature; MODIFIER	silent_mutation	Average:42.642; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N
vg1104591250	T -> G	LOC_Os11g08630-LOC_Os11g08640	intergenic_region ; MODIFIER	silent_mutation	Average:42.642; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104591250	NA	3.54E-06	mr1406	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104591250	NA	8.42E-06	mr1633	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104591250	NA	1.50E-06	mr1933	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104591250	1.74E-06	7.97E-07	mr1981	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251