| Variant ID: vg1104526300 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4526300 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCTTAATTAATCCATGATTAGCCTATGTGATGCTACAGTAAATATTTGCTAATTATGGATTAATTAGGCTTAAAAAAATTCATCTCGTGGATTAGCTCT[C/T]
ATTTGTGAAATTAGTTTTTTATTAGTCTATGTTTAATATTCTAAATTATTATATAAACATCCGATATAATAGTAACTAACAAAATTTTAGCGCCATCTAA
TTAGATGGCGCTAAAATTTTGTTAGTTACTATTATATCGGATGTTTATATAATAATTTAGAATATTAAACATAGACTAATAAAAAACTAATTTCACAAAT[G/A]
AGAGCTAATCCACGAGATGAATTTTTTTAAGCCTAATTAATCCATAATTAGCAAATATTTACTGTAGCATCACATAGGCTAATCATGGATTAATTAAGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 2.40% | 19.11% | 26.83% | NA |
| All Indica | 2759 | 24.80% | 3.80% | 28.16% | 43.24% | NA |
| All Japonica | 1512 | 94.60% | 0.20% | 2.98% | 2.18% | NA |
| Aus | 269 | 71.40% | 0.40% | 17.84% | 10.41% | NA |
| Indica I | 595 | 45.70% | 1.20% | 13.61% | 39.50% | NA |
| Indica II | 465 | 15.10% | 6.00% | 41.94% | 36.99% | NA |
| Indica III | 913 | 20.00% | 3.60% | 26.73% | 49.62% | NA |
| Indica Intermediate | 786 | 20.40% | 4.60% | 32.70% | 42.37% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.26% | 0.65% | NA |
| Tropical Japonica | 504 | 86.70% | 0.60% | 7.54% | 5.16% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 2.07% | 0.83% | NA |
| VI/Aromatic | 96 | 83.30% | 1.00% | 15.62% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 3.30% | 20.00% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104526300 | C -> T | LOC_Os11g08569.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.785; most accessible tissue: Callus, score: 70.332 | N | N | N | N |
| vg1104526300 | C -> DEL | N | N | silent_mutation | Average:35.785; most accessible tissue: Callus, score: 70.332 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104526300 | NA | 2.07E-06 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104526300 | NA | 2.50E-10 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104526300 | 9.25E-07 | NA | mr1337 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104526300 | NA | 7.42E-06 | mr1505 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104526300 | NA | 6.68E-29 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104526300 | 9.83E-06 | 4.05E-08 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104526300 | 8.29E-06 | NA | mr1923 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104526300 | NA | 4.30E-07 | mr1933 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |