Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104469034:

Variant ID: vg1104469034 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 4469034
Reference Allele: TAlternative Allele: TTTAC,C,TTTTAC,TAC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGCTGCTCCAACCGTTGAATAAAAAGTCAATCCAGTATTAGATGTGTAGTACCGTGTTATAATGTATCACATCATATTTTAGATTTGTTTTTTTTTGGA[T/TTTAC,C,TTTTAC,TAC]
TGATTGAGTAGAAAACAGCTACTATTTCTCACCAAAGATGGTATTGGTTGGGTTGAGTGCGGACTGGTTGAAGGCAGCGTCGCCGACGAAGCTGTCGTCG

Reverse complement sequence

CGACGACAGCTTCGTCGGCGACGCTGCCTTCAACCAGTCCGCACTCAACCCAACCAATACCATCTTTGGTGAGAAATAGTAGCTGTTTTCTACTCAATCA[A/GTAAA,G,GTAAAA,GTA]
TCCAAAAAAAAACAAATCTAAAATATGATGTGATACATTATAACACGGTACTACACATCTAATACTGGATTGACTTTTTATTCAACGGTTGGAGCAGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.30% 26.20% 1.18% 20.50% TTTAC: 19.95%; TAC: 2.86%; TTTTAC: 0.04%
All Indica  2759 42.90% 5.00% 0.76% 13.05% TTTAC: 33.42%; TAC: 4.82%; TTTTAC: 0.07%
All Japonica  1512 5.60% 66.10% 1.12% 26.79% TTTAC: 0.46%
Aus  269 32.30% 0.70% 0.37% 66.17% TTTAC: 0.37%
Indica I  595 5.50% 1.30% 1.51% 40.84% TTTAC: 40.50%; TAC: 10.25%
Indica II  465 78.70% 1.70% 0.00% 2.80% TTTAC: 15.27%; TAC: 1.29%; TTTTAC: 0.22%
Indica III  913 45.20% 7.80% 0.66% 5.26% TTTAC: 37.90%; TAC: 3.07%; TTTTAC: 0.11%
Indica Intermediate  786 47.20% 6.50% 0.76% 7.12% TTTAC: 33.59%; TAC: 4.83%
Temperate Japonica  767 1.00% 53.30% 1.96% 43.02% TTTAC: 0.65%
Tropical Japonica  504 13.90% 81.00% 0.00% 4.96% TTTAC: 0.20%
Japonica Intermediate  241 2.50% 75.50% 0.83% 20.75% TTTAC: 0.41%
VI/Aromatic  96 2.10% 64.60% 15.62% 15.62% TTTAC: 2.08%
Intermediate  90 31.10% 40.00% 2.22% 12.22% TTTAC: 12.22%; TAC: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104469034 T -> TTTAC LOC_Os11g08460.2 upstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:69.12; most accessible tissue: Minghui63 root, score: 89.072 N N N N
vg1104469034 T -> TTTAC LOC_Os11g08460.1 intron_variant ; MODIFIER silent_mutation Average:69.12; most accessible tissue: Minghui63 root, score: 89.072 N N N N
vg1104469034 T -> TTTTAC LOC_Os11g08460.2 upstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:69.12; most accessible tissue: Minghui63 root, score: 89.072 N N N N
vg1104469034 T -> TTTTAC LOC_Os11g08460.1 intron_variant ; MODIFIER silent_mutation Average:69.12; most accessible tissue: Minghui63 root, score: 89.072 N N N N
vg1104469034 T -> TAC LOC_Os11g08460.2 upstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:69.12; most accessible tissue: Minghui63 root, score: 89.072 N N N N
vg1104469034 T -> TAC LOC_Os11g08460.1 intron_variant ; MODIFIER silent_mutation Average:69.12; most accessible tissue: Minghui63 root, score: 89.072 N N N N
vg1104469034 T -> DEL N N silent_mutation Average:69.12; most accessible tissue: Minghui63 root, score: 89.072 N N N N
vg1104469034 T -> C LOC_Os11g08460.2 upstream_gene_variant ; 720.0bp to feature; MODIFIER silent_mutation Average:69.12; most accessible tissue: Minghui63 root, score: 89.072 N N N N
vg1104469034 T -> C LOC_Os11g08460.1 intron_variant ; MODIFIER silent_mutation Average:69.12; most accessible tissue: Minghui63 root, score: 89.072 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1104469034 T C -0.06 -0.01 0.0 0.01 0.0 -0.01
vg1104469034 T TAC 0.02 -0.02 -0.01 -0.03 -0.05 -0.1
vg1104469034 T TTTAC -0.42 -0.07 -0.03 -0.06 -0.09 -0.1
vg1104469034 T TTTTA* -0.33 0.02 0.07 0.03 0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104469034 NA 1.08E-09 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104469034 7.82E-06 NA mr1337 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104469034 3.66E-06 2.11E-29 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104469034 3.65E-06 2.79E-08 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104469034 4.20E-06 NA mr1923 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104469034 NA 2.96E-06 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251