\
| Variant ID: vg1104463006 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4463006 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCGATTGGCATCCTAATGCAATGTGCTGCTACAGGGATTTGATTATTGGATAGTTGCATCGATTTTGTAACATGAATAAAAAATTTTGATTTAGAAAAAA[A/G]
CCAACTGAATTTAAGAAAAAAGTTTCAGTTAATTAGCAAGCGCCTCACTGATAAAAAGAACCGTACGTGACGTGCAGGAAGTGTCCAATTGTCCACATAG
CTATGTGGACAATTGGACACTTCCTGCACGTCACGTACGGTTCTTTTTATCAGTGAGGCGCTTGCTAATTAACTGAAACTTTTTTCTTAAATTCAGTTGG[T/C]
TTTTTTCTAAATCAAAATTTTTTATTCATGTTACAAAATCGATGCAACTATCCAATAATCAAATCCCTGTAGCAGCACATTGCATTAGGATGCCAATCGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.90% | 19.30% | 0.93% | 0.87% | NA |
| All Indica | 2759 | 86.80% | 12.00% | 0.47% | 0.65% | NA |
| All Japonica | 1512 | 72.80% | 24.60% | 1.46% | 1.19% | NA |
| Aus | 269 | 34.20% | 61.00% | 2.97% | 1.86% | NA |
| Indica I | 595 | 59.20% | 38.00% | 1.18% | 1.68% | NA |
| Indica II | 465 | 97.00% | 2.80% | 0.00% | 0.22% | NA |
| Indica III | 913 | 94.70% | 4.60% | 0.33% | 0.33% | NA |
| Indica Intermediate | 786 | 92.60% | 6.50% | 0.38% | 0.51% | NA |
| Temperate Japonica | 767 | 56.30% | 39.10% | 2.22% | 2.35% | NA |
| Tropical Japonica | 504 | 95.00% | 4.40% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 20.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 31.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104463006 | A -> DEL | N | N | silent_mutation | Average:42.81; most accessible tissue: Callus, score: 78.967 | N | N | N | N |
| vg1104463006 | A -> G | LOC_Os11g08450.1 | upstream_gene_variant ; 608.0bp to feature; MODIFIER | silent_mutation | Average:42.81; most accessible tissue: Callus, score: 78.967 | N | N | N | N |
| vg1104463006 | A -> G | LOC_Os11g08460.1 | downstream_gene_variant ; 3293.0bp to feature; MODIFIER | silent_mutation | Average:42.81; most accessible tissue: Callus, score: 78.967 | N | N | N | N |
| vg1104463006 | A -> G | LOC_Os11g08460.2 | downstream_gene_variant ; 3278.0bp to feature; MODIFIER | silent_mutation | Average:42.81; most accessible tissue: Callus, score: 78.967 | N | N | N | N |
| vg1104463006 | A -> G | LOC_Os11g08450-LOC_Os11g08460 | intergenic_region ; MODIFIER | silent_mutation | Average:42.81; most accessible tissue: Callus, score: 78.967 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104463006 | NA | 1.32E-07 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104463006 | NA | 7.29E-09 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104463006 | NA | 8.28E-07 | mr1219 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104463006 | NA | 3.02E-07 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104463006 | NA | 6.84E-10 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104463006 | 2.78E-06 | 9.59E-14 | mr1274 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104463006 | 2.15E-06 | 4.25E-09 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104463006 | NA | 3.63E-07 | mr1933 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104463006 | NA | 6.28E-06 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104463006 | NA | 3.44E-08 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104463006 | NA | 5.16E-08 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |