Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104463006:

Variant ID: vg1104463006 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4463006
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGATTGGCATCCTAATGCAATGTGCTGCTACAGGGATTTGATTATTGGATAGTTGCATCGATTTTGTAACATGAATAAAAAATTTTGATTTAGAAAAAA[A/G]
CCAACTGAATTTAAGAAAAAAGTTTCAGTTAATTAGCAAGCGCCTCACTGATAAAAAGAACCGTACGTGACGTGCAGGAAGTGTCCAATTGTCCACATAG

Reverse complement sequence

CTATGTGGACAATTGGACACTTCCTGCACGTCACGTACGGTTCTTTTTATCAGTGAGGCGCTTGCTAATTAACTGAAACTTTTTTCTTAAATTCAGTTGG[T/C]
TTTTTTCTAAATCAAAATTTTTTATTCATGTTACAAAATCGATGCAACTATCCAATAATCAAATCCCTGTAGCAGCACATTGCATTAGGATGCCAATCGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.90%	19.30%	0.93%	0.87%	NA
All Indica	2759	86.80%	12.00%	0.47%	0.65%	NA
All Japonica	1512	72.80%	24.60%	1.46%	1.19%	NA
Aus	269	34.20%	61.00%	2.97%	1.86%	NA
Indica I	595	59.20%	38.00%	1.18%	1.68%	NA
Indica II	465	97.00%	2.80%	0.00%	0.22%	NA
Indica III	913	94.70%	4.60%	0.33%	0.33%	NA
Indica Intermediate	786	92.60%	6.50%	0.38%	0.51%	NA
Temperate Japonica	767	56.30%	39.10%	2.22%	2.35%	NA
Tropical Japonica	504	95.00%	4.40%	0.60%	0.00%	NA
Japonica Intermediate	241	78.40%	20.70%	0.83%	0.00%	NA
VI/Aromatic	96	67.70%	31.20%	1.04%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104463006	A -> DEL	N	N	silent_mutation	Average:42.81; most accessible tissue: Callus, score: 78.967	N	N	N	N
vg1104463006	A -> G	LOC_Os11g08450.1	upstream_gene_variant ; 608.0bp to feature; MODIFIER	silent_mutation	Average:42.81; most accessible tissue: Callus, score: 78.967	N	N	N	N
vg1104463006	A -> G	LOC_Os11g08460.1	downstream_gene_variant ; 3293.0bp to feature; MODIFIER	silent_mutation	Average:42.81; most accessible tissue: Callus, score: 78.967	N	N	N	N
vg1104463006	A -> G	LOC_Os11g08460.2	downstream_gene_variant ; 3278.0bp to feature; MODIFIER	silent_mutation	Average:42.81; most accessible tissue: Callus, score: 78.967	N	N	N	N
vg1104463006	A -> G	LOC_Os11g08450-LOC_Os11g08460	intergenic_region ; MODIFIER	silent_mutation	Average:42.81; most accessible tissue: Callus, score: 78.967	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104463006	NA	1.32E-07	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006	NA	7.29E-09	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006	NA	8.28E-07	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006	NA	3.02E-07	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006	NA	6.84E-10	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006	2.78E-06	9.59E-14	mr1274	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006	2.15E-06	4.25E-09	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006	NA	3.63E-07	mr1933	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006	NA	6.28E-06	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006	NA	3.44E-08	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006	NA	5.16E-08	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251