\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104463006:

Variant ID: vg1104463006 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4463006
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGATTGGCATCCTAATGCAATGTGCTGCTACAGGGATTTGATTATTGGATAGTTGCATCGATTTTGTAACATGAATAAAAAATTTTGATTTAGAAAAAA[A/G]
CCAACTGAATTTAAGAAAAAAGTTTCAGTTAATTAGCAAGCGCCTCACTGATAAAAAGAACCGTACGTGACGTGCAGGAAGTGTCCAATTGTCCACATAG

Reverse complement sequence

CTATGTGGACAATTGGACACTTCCTGCACGTCACGTACGGTTCTTTTTATCAGTGAGGCGCTTGCTAATTAACTGAAACTTTTTTCTTAAATTCAGTTGG[T/C]
TTTTTTCTAAATCAAAATTTTTTATTCATGTTACAAAATCGATGCAACTATCCAATAATCAAATCCCTGTAGCAGCACATTGCATTAGGATGCCAATCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.90% 19.30% 0.93% 0.87% NA
All Indica  2759 86.80% 12.00% 0.47% 0.65% NA
All Japonica  1512 72.80% 24.60% 1.46% 1.19% NA
Aus  269 34.20% 61.00% 2.97% 1.86% NA
Indica I  595 59.20% 38.00% 1.18% 1.68% NA
Indica II  465 97.00% 2.80% 0.00% 0.22% NA
Indica III  913 94.70% 4.60% 0.33% 0.33% NA
Indica Intermediate  786 92.60% 6.50% 0.38% 0.51% NA
Temperate Japonica  767 56.30% 39.10% 2.22% 2.35% NA
Tropical Japonica  504 95.00% 4.40% 0.60% 0.00% NA
Japonica Intermediate  241 78.40% 20.70% 0.83% 0.00% NA
VI/Aromatic  96 67.70% 31.20% 1.04% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104463006 A -> DEL N N silent_mutation Average:42.81; most accessible tissue: Callus, score: 78.967 N N N N
vg1104463006 A -> G LOC_Os11g08450.1 upstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:42.81; most accessible tissue: Callus, score: 78.967 N N N N
vg1104463006 A -> G LOC_Os11g08460.1 downstream_gene_variant ; 3293.0bp to feature; MODIFIER silent_mutation Average:42.81; most accessible tissue: Callus, score: 78.967 N N N N
vg1104463006 A -> G LOC_Os11g08460.2 downstream_gene_variant ; 3278.0bp to feature; MODIFIER silent_mutation Average:42.81; most accessible tissue: Callus, score: 78.967 N N N N
vg1104463006 A -> G LOC_Os11g08450-LOC_Os11g08460 intergenic_region ; MODIFIER silent_mutation Average:42.81; most accessible tissue: Callus, score: 78.967 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104463006 NA 1.32E-07 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006 NA 7.29E-09 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006 NA 8.28E-07 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006 NA 3.02E-07 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006 NA 6.84E-10 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006 2.78E-06 9.59E-14 mr1274 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006 2.15E-06 4.25E-09 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006 NA 3.63E-07 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006 NA 6.28E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006 NA 3.44E-08 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104463006 NA 5.16E-08 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251