\
| Variant ID: vg1104456316 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 4456316 |
| Reference Allele: GA | Alternative Allele: AA,G |
| Primary Allele: GA | Secondary Allele: AA |
Inferred Ancestral Allele: Not determined.
AAGTGGAGTATAGAGTCCATATAGAAATACAATTAGGAAATAGTTGAAATTTGGAATTAAAAAATAAGGATTATTAGAAGAGAAGACTAGAGTCCATATA[GA/AA,G]
AATACAATTTAAAAATAGTTGAAATTCGGAGTTAAAAAATAAGGAATATTAGAAGAGGAGACTAGAGTCCATATAGAAATATAATTAGGAAATAACTGAA
TTCAGTTATTTCCTAATTATATTTCTATATGGACTCTAGTCTCCTCTTCTAATATTCCTTATTTTTTAACTCCGAATTTCAACTATTTTTAAATTGTATT[TC/TT,C]
TATATGGACTCTAGTCTTCTCTTCTAATAATCCTTATTTTTTAATTCCAAATTTCAACTATTTCCTAATTGTATTTCTATATGGACTCTATACTCCACTT
| Populations | Population Size | Frequency of GA(primary allele) | Frequency of AA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 19.30% | 0.99% | 0.49% | NA |
| All Indica | 2759 | 86.90% | 12.30% | 0.69% | 0.18% | NA |
| All Japonica | 1512 | 72.30% | 25.60% | 1.32% | 0.79% | NA |
| Aus | 269 | 35.30% | 59.90% | 2.97% | 1.86% | NA |
| Indica I | 595 | 59.50% | 39.00% | 1.34% | 0.17% | NA |
| Indica II | 465 | 97.00% | 2.20% | 0.65% | 0.22% | NA |
| Indica III | 913 | 94.70% | 4.90% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 92.50% | 6.50% | 0.76% | 0.25% | NA |
| Temperate Japonica | 767 | 55.40% | 41.10% | 2.09% | 1.43% | NA |
| Tropical Japonica | 504 | 95.00% | 4.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 19.90% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 82.30% | 16.70% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104456316 | GA -> AA | LOC_Os11g08445.1 | downstream_gene_variant ; 4092.0bp to feature; MODIFIER | silent_mutation | Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1104456316 | GA -> AA | LOC_Os11g08450.1 | downstream_gene_variant ; 4289.0bp to feature; MODIFIER | silent_mutation | Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1104456316 | GA -> AA | LOC_Os11g08445-LOC_Os11g08450 | intergenic_region ; MODIFIER | silent_mutation | Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1104456316 | GA -> DEL | N | N | silent_mutation | Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1104456316 | GA -> G | LOC_Os11g08445.1 | downstream_gene_variant ; 4093.0bp to feature; MODIFIER | N | Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1104456316 | GA -> G | LOC_Os11g08450.1 | downstream_gene_variant ; 4288.0bp to feature; MODIFIER | N | Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1104456316 | GA -> G | LOC_Os11g08445-LOC_Os11g08450 | intergenic_region ; MODIFIER | N | Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104456316 | NA | 6.23E-06 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | NA | 1.61E-07 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | NA | 3.70E-06 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | NA | 7.82E-08 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | NA | 6.50E-12 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | NA | 7.92E-06 | mr1406 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | NA | 3.21E-06 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | 5.74E-06 | 5.74E-06 | mr1487 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | 4.07E-07 | 1.85E-09 | mr1638 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | NA | 8.29E-08 | mr1933 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | NA | 9.14E-06 | mr1397_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104456316 | NA | 4.10E-07 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |