\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104456316:

Variant ID: vg1104456316 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 4456316
Reference Allele: GAAlternative Allele: AA,G
Primary Allele: GASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTGGAGTATAGAGTCCATATAGAAATACAATTAGGAAATAGTTGAAATTTGGAATTAAAAAATAAGGATTATTAGAAGAGAAGACTAGAGTCCATATA[GA/AA,G]
AATACAATTTAAAAATAGTTGAAATTCGGAGTTAAAAAATAAGGAATATTAGAAGAGGAGACTAGAGTCCATATAGAAATATAATTAGGAAATAACTGAA

Reverse complement sequence

TTCAGTTATTTCCTAATTATATTTCTATATGGACTCTAGTCTCCTCTTCTAATATTCCTTATTTTTTAACTCCGAATTTCAACTATTTTTAAATTGTATT[TC/TT,C]
TATATGGACTCTAGTCTTCTCTTCTAATAATCCTTATTTTTTAATTCCAAATTTCAACTATTTCCTAATTGTATTTCTATATGGACTCTATACTCCACTT

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 19.30% 0.99% 0.49% NA
All Indica  2759 86.90% 12.30% 0.69% 0.18% NA
All Japonica  1512 72.30% 25.60% 1.32% 0.79% NA
Aus  269 35.30% 59.90% 2.97% 1.86% NA
Indica I  595 59.50% 39.00% 1.34% 0.17% NA
Indica II  465 97.00% 2.20% 0.65% 0.22% NA
Indica III  913 94.70% 4.90% 0.22% 0.11% NA
Indica Intermediate  786 92.50% 6.50% 0.76% 0.25% NA
Temperate Japonica  767 55.40% 41.10% 2.09% 1.43% NA
Tropical Japonica  504 95.00% 4.80% 0.20% 0.00% NA
Japonica Intermediate  241 78.40% 19.90% 1.24% 0.41% NA
VI/Aromatic  96 82.30% 16.70% 0.00% 1.04% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104456316 GA -> AA LOC_Os11g08445.1 downstream_gene_variant ; 4092.0bp to feature; MODIFIER silent_mutation Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1104456316 GA -> AA LOC_Os11g08450.1 downstream_gene_variant ; 4289.0bp to feature; MODIFIER silent_mutation Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1104456316 GA -> AA LOC_Os11g08445-LOC_Os11g08450 intergenic_region ; MODIFIER silent_mutation Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1104456316 GA -> DEL N N silent_mutation Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1104456316 GA -> G LOC_Os11g08445.1 downstream_gene_variant ; 4093.0bp to feature; MODIFIER N Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1104456316 GA -> G LOC_Os11g08450.1 downstream_gene_variant ; 4288.0bp to feature; MODIFIER N Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1104456316 GA -> G LOC_Os11g08445-LOC_Os11g08450 intergenic_region ; MODIFIER N Average:20.597; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104456316 NA 6.23E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 NA 1.61E-07 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 NA 3.70E-06 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 NA 7.82E-08 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 NA 6.50E-12 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 NA 7.92E-06 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 NA 3.21E-06 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 5.74E-06 5.74E-06 mr1487 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 4.07E-07 1.85E-09 mr1638 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 NA 8.29E-08 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 NA 9.14E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104456316 NA 4.10E-07 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251