\
| Variant ID: vg1104448944 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4448944 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 82. )
TCATCACCAACGACCAGGGCAACCGCATCACCCCCTCCTGCGTCGCCTTCACCGCCGACGACAGGTTCGTCGGCGACGCCGCCGAGAATCAGGCCGCCCT[C/T]
AACCCCACCAACACCATCTTCGGTCATAAAACACACTCACTCGTTTATACTGCTATGCTAGCTTCTTGTTATTTTTCTTCCATCTTCCAAGGACCAGCAT
ATGCTGGTCCTTGGAAGATGGAAGAAAAATAACAAGAAGCTAGCATAGCAGTATAAACGAGTGAGTGTGTTTTATGACCGAAGATGGTGTTGGTGGGGTT[G/A]
AGGGCGGCCTGATTCTCGGCGGCGTCGCCGACGAACCTGTCGTCGGCGGTGAAGGCGACGCAGGAGGGGGTGATGCGGTTGCCCTGGTCGTTGGTGATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 23.50% | 7.81% | 1.93% | NA |
| All Indica | 2759 | 67.00% | 25.50% | 6.09% | 1.41% | NA |
| All Japonica | 1512 | 71.60% | 15.30% | 10.45% | 2.58% | NA |
| Aus | 269 | 33.50% | 48.70% | 13.75% | 4.09% | NA |
| Indica I | 595 | 45.90% | 27.20% | 22.02% | 4.87% | NA |
| Indica II | 465 | 91.60% | 8.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 61.00% | 37.20% | 1.31% | 0.44% | NA |
| Indica Intermediate | 786 | 75.30% | 21.00% | 2.93% | 0.76% | NA |
| Temperate Japonica | 767 | 54.20% | 24.90% | 16.43% | 4.43% | NA |
| Tropical Japonica | 504 | 94.80% | 4.20% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 78.40% | 8.30% | 11.62% | 1.66% | NA |
| VI/Aromatic | 96 | 66.70% | 31.20% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 77.80% | 15.60% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104448944 | C -> T | LOC_Os11g08445.1 | synonymous_variant ; p.Leu101Leu; LOW | synonymous_codon | Average:68.6; most accessible tissue: Minghui63 root, score: 84.069 | N | N | N | N |
| vg1104448944 | C -> DEL | LOC_Os11g08445.1 | N | frameshift_variant | Average:68.6; most accessible tissue: Minghui63 root, score: 84.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104448944 | NA | 8.70E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | NA | 2.03E-06 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | NA | 3.66E-06 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | NA | 2.57E-09 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | 9.07E-06 | NA | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | NA | 2.60E-06 | mr1933 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | 4.81E-06 | 4.81E-06 | mr1312_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | 7.04E-08 | 2.60E-09 | mr1397_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | NA | 3.85E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | NA | 9.51E-06 | mr1766_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | 1.87E-06 | 3.03E-06 | mr1843_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448944 | 7.04E-06 | 7.04E-06 | mr1843_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |