\
| Variant ID: vg1104448929 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4448929 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, G: 0.20, others allele: 0.00, population size: 82. )
ACAACCGCAGCGAGGTCATCACCAACGACCAGGGCAACCGCATCACCCCCTCCTGCGTCGCCTTCACCGCCGACGACAGGTTCGTCGGCGACGCCGCCGA[G/C]
AATCAGGCCGCCCTCAACCCCACCAACACCATCTTCGGTCATAAAACACACTCACTCGTTTATACTGCTATGCTAGCTTCTTGTTATTTTTCTTCCATCT
AGATGGAAGAAAAATAACAAGAAGCTAGCATAGCAGTATAAACGAGTGAGTGTGTTTTATGACCGAAGATGGTGTTGGTGGGGTTGAGGGCGGCCTGATT[C/G]
TCGGCGGCGTCGCCGACGAACCTGTCGTCGGCGGTGAAGGCGACGCAGGAGGGGGTGATGCGGTTGCCCTGGTCGTTGGTGATGACCTCGCTGCGGTTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 22.90% | 7.81% | 2.54% | NA |
| All Indica | 2759 | 67.10% | 25.00% | 6.23% | 1.67% | NA |
| All Japonica | 1512 | 71.60% | 14.50% | 10.38% | 3.57% | NA |
| Aus | 269 | 33.50% | 47.20% | 12.64% | 6.69% | NA |
| Indica I | 595 | 45.90% | 26.10% | 22.69% | 5.38% | NA |
| Indica II | 465 | 91.60% | 8.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 61.10% | 37.20% | 1.20% | 0.44% | NA |
| Indica Intermediate | 786 | 75.40% | 20.20% | 3.05% | 1.27% | NA |
| Temperate Japonica | 767 | 54.10% | 23.30% | 16.69% | 5.87% | NA |
| Tropical Japonica | 504 | 94.80% | 4.00% | 0.79% | 0.40% | NA |
| Japonica Intermediate | 241 | 78.40% | 8.30% | 10.37% | 2.90% | NA |
| VI/Aromatic | 96 | 66.70% | 31.20% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 77.80% | 15.60% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104448929 | G -> DEL | LOC_Os11g08445.1 | N | frameshift_variant | Average:69.988; most accessible tissue: Minghui63 root, score: 84.069 | N | N | N | N |
| vg1104448929 | G -> C | LOC_Os11g08445.1 | missense_variant ; p.Glu96Asp; MODERATE | nonsynonymous_codon ; E96D | Average:69.988; most accessible tissue: Minghui63 root, score: 84.069 | benign |
0.016 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104448929 | NA | 3.05E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | 8.87E-06 | 8.87E-06 | mr1126 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | NA | 6.36E-06 | mr1177 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | NA | 1.21E-06 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | NA | 1.33E-06 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | NA | 1.29E-09 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | 5.43E-06 | 5.43E-06 | mr1487 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | NA | 3.60E-06 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | 5.92E-06 | NA | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | NA | 1.06E-06 | mr1933 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | 6.21E-08 | 3.27E-09 | mr1397_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | NA | 5.47E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104448929 | 3.02E-06 | 5.30E-06 | mr1843_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |