\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104435123:

Variant ID: vg1104435123 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4435123
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCACGCGCTACACCTCGATTGGATGCGATATGGCCTGTGGTACTAGAAGCACCTTCTTTTTAGGATTATTTTTAAAAATATATTATTTTTTGGTGATAT[C/A]
GTAGGAATACATTGGTTTCAAAAATGTACCTGATTGCTCGGTTAAAAGATGTGAGTGTTACCAATCCACCGGATGATACTTATAGTCTGAATGACATGTG

Reverse complement sequence

CACATGTCATTCAGACTATAAGTATCATCCGGTGGATTGGTAACACTCACATCTTTTAACCGAGCAATCAGGTACATTTTTGAAACCAATGTATTCCTAC[G/T]
ATATCACCAAAAAATAATATATTTTTAAAAATAATCCTAAAAAGAAGGTGCTTCTAGTACCACAGGCCATATCGCATCCAATCGAGGTGTAGCGCGTGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 16.40% 0.57% 0.00% NA
All Indica  2759 89.10% 10.60% 0.33% 0.00% NA
All Japonica  1512 79.60% 19.40% 0.93% 0.00% NA
Aus  269 33.10% 66.20% 0.74% 0.00% NA
Indica I  595 58.50% 40.70% 0.84% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.10% 0.51% 0.00% NA
Temperate Japonica  767 65.10% 33.20% 1.69% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 84.60% 14.90% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104435123 C -> A LOC_Os11g08400.1 upstream_gene_variant ; 3679.0bp to feature; MODIFIER silent_mutation Average:55.616; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg1104435123 C -> A LOC_Os11g08410.1 upstream_gene_variant ; 1052.0bp to feature; MODIFIER silent_mutation Average:55.616; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg1104435123 C -> A LOC_Os11g08420.1 downstream_gene_variant ; 2931.0bp to feature; MODIFIER silent_mutation Average:55.616; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg1104435123 C -> A LOC_Os11g08410-LOC_Os11g08420 intergenic_region ; MODIFIER silent_mutation Average:55.616; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104435123 NA 1.32E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 5.42E-09 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 6.34E-07 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 5.46E-08 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 3.67E-13 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 4.87E-06 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 7.48E-06 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 4.82E-06 1.36E-08 mr1638 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 8.74E-06 mr1901 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 1.36E-07 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 3.13E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 7.71E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 3.28E-07 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 4.54E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104435123 NA 1.17E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251