\
| Variant ID: vg1104435123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4435123 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCCACGCGCTACACCTCGATTGGATGCGATATGGCCTGTGGTACTAGAAGCACCTTCTTTTTAGGATTATTTTTAAAAATATATTATTTTTTGGTGATAT[C/A]
GTAGGAATACATTGGTTTCAAAAATGTACCTGATTGCTCGGTTAAAAGATGTGAGTGTTACCAATCCACCGGATGATACTTATAGTCTGAATGACATGTG
CACATGTCATTCAGACTATAAGTATCATCCGGTGGATTGGTAACACTCACATCTTTTAACCGAGCAATCAGGTACATTTTTGAAACCAATGTATTCCTAC[G/T]
ATATCACCAAAAAATAATATATTTTTAAAAATAATCCTAAAAAGAAGGTGCTTCTAGTACCACAGGCCATATCGCATCCAATCGAGGTGTAGCGCGTGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.00% | 16.40% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 89.10% | 10.60% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 79.60% | 19.40% | 0.93% | 0.00% | NA |
| Aus | 269 | 33.10% | 66.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 58.50% | 40.70% | 0.84% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 65.10% | 33.20% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.60% | 14.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104435123 | C -> A | LOC_Os11g08400.1 | upstream_gene_variant ; 3679.0bp to feature; MODIFIER | silent_mutation | Average:55.616; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg1104435123 | C -> A | LOC_Os11g08410.1 | upstream_gene_variant ; 1052.0bp to feature; MODIFIER | silent_mutation | Average:55.616; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg1104435123 | C -> A | LOC_Os11g08420.1 | downstream_gene_variant ; 2931.0bp to feature; MODIFIER | silent_mutation | Average:55.616; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg1104435123 | C -> A | LOC_Os11g08410-LOC_Os11g08420 | intergenic_region ; MODIFIER | silent_mutation | Average:55.616; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104435123 | NA | 1.32E-06 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 5.42E-09 | mr1201 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 6.34E-07 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 5.46E-08 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 3.67E-13 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 4.87E-06 | mr1406 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 7.48E-06 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | 4.82E-06 | 1.36E-08 | mr1638 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 8.74E-06 | mr1901 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 1.36E-07 | mr1933 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 3.13E-06 | mr1201_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 7.71E-06 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 3.28E-07 | mr1274_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 4.54E-06 | mr1397_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104435123 | NA | 1.17E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |