\
| Variant ID: vg1104422127 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4422127 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCGGTGCCCAAGGCTTCCATATTAGGATGTTGAAGTTGGTGGCAGTAGTACCTAGGAGCTGCGCTTTGTAGGCCGACGTCGCCGTATATTCACCGTGGCT[A/T]
GTGAGCTTCCACACTATCTTGTCCTCCTCATTCTCTGTGAAATGTACGTTGTGCACCGCACTCCAGACATTGATTAGCTGGCTGACCAGCTCCATTGTCC
GGACAATGGAGCTGGTCAGCCAGCTAATCAATGTCTGGAGTGCGGTGCACAACGTACATTTCACAGAGAATGAGGAGGACAAGATAGTGTGGAAGCTCAC[T/A]
AGCCACGGTGAATATACGGCGACGTCGGCCTACAAAGCGCAGCTCCTAGGTACTACTGCCACCAACTTCAACATCCTAATATGGAAGCCTTGGGCACCGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 5.40% | 2.01% | 29.92% | NA |
| All Indica | 2759 | 55.50% | 7.80% | 2.83% | 33.96% | NA |
| All Japonica | 1512 | 68.30% | 2.20% | 0.79% | 28.64% | NA |
| Aus | 269 | 91.80% | 0.40% | 0.37% | 7.43% | NA |
| Indica I | 595 | 79.00% | 1.00% | 1.51% | 18.49% | NA |
| Indica II | 465 | 35.90% | 4.70% | 3.01% | 56.34% | NA |
| Indica III | 913 | 44.70% | 15.30% | 3.07% | 36.91% | NA |
| Indica Intermediate | 786 | 61.70% | 5.90% | 3.44% | 29.01% | NA |
| Temperate Japonica | 767 | 60.90% | 0.30% | 0.91% | 37.94% | NA |
| Tropical Japonica | 504 | 74.20% | 5.40% | 0.99% | 19.44% | NA |
| Japonica Intermediate | 241 | 79.70% | 2.10% | 0.00% | 18.26% | NA |
| VI/Aromatic | 96 | 93.80% | 2.10% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 4.40% | 0.00% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104422127 | A -> T | LOC_Os11g08390.1 | synonymous_variant ; p.Thr414Thr; LOW | synonymous_codon | Average:14.9; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg1104422127 | A -> DEL | LOC_Os11g08390.1 | N | frameshift_variant | Average:14.9; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104422127 | 7.01E-06 | 3.87E-08 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422127 | 7.02E-06 | 1.72E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422127 | 1.87E-08 | 3.20E-10 | mr1841 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422127 | 1.82E-07 | 1.82E-07 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422127 | NA | 5.33E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422127 | NA | 7.89E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422127 | NA | 2.67E-07 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |