\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104422091:

Variant ID: vg1104422091 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4422091
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGGATGATCAACCAGGCAAAGGTCTTGCACTTGCGCGGTGCCCAAGGCTTCCATATTAGGATGTTGAAGTTGGTGGCAGTAGTACCTAGGAGCTGCGC[T/C]
TTGTAGGCCGACGTCGCCGTATATTCACCGTGGCTAGTGAGCTTCCACACTATCTTGTCCTCCTCATTCTCTGTGAAATGTACGTTGTGCACCGCACTCC

Reverse complement sequence

GGAGTGCGGTGCACAACGTACATTTCACAGAGAATGAGGAGGACAAGATAGTGTGGAAGCTCACTAGCCACGGTGAATATACGGCGACGTCGGCCTACAA[A/G]
GCGCAGCTCCTAGGTACTACTGCCACCAACTTCAACATCCTAATATGGAAGCCTTGGGCACCGCGCAAGTGCAAGACCTTTGCCTGGTTGATCATCCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 5.30% 1.57% 30.13% NA
All Indica  2759 56.00% 7.50% 2.28% 34.14% NA
All Japonica  1512 68.50% 2.20% 0.40% 28.90% NA
Aus  269 91.40% 0.70% 0.00% 7.81% NA
Indica I  595 77.80% 0.70% 2.02% 19.50% NA
Indica II  465 37.00% 4.30% 3.01% 55.70% NA
Indica III  913 45.50% 15.10% 2.63% 36.80% NA
Indica Intermediate  786 63.10% 5.90% 1.65% 29.39% NA
Temperate Japonica  767 60.90% 0.30% 0.52% 38.33% NA
Tropical Japonica  504 74.60% 5.40% 0.40% 19.64% NA
Japonica Intermediate  241 79.70% 2.10% 0.00% 18.26% NA
VI/Aromatic  96 93.80% 2.10% 4.17% 0.00% NA
Intermediate  90 68.90% 3.30% 1.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104422091 T -> DEL LOC_Os11g08390.1 N frameshift_variant Average:13.634; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg1104422091 T -> C LOC_Os11g08390.1 synonymous_variant ; p.Lys426Lys; LOW synonymous_codon Average:13.634; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104422091 NA 2.43E-07 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104422091 NA 4.52E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104422091 1.47E-07 1.49E-10 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104422091 2.06E-09 2.06E-09 mr1900 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104422091 NA 7.19E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104422091 NA 2.25E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104422091 NA 4.48E-08 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251