| Variant ID: vg1104422091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4422091 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTGGATGATCAACCAGGCAAAGGTCTTGCACTTGCGCGGTGCCCAAGGCTTCCATATTAGGATGTTGAAGTTGGTGGCAGTAGTACCTAGGAGCTGCGC[T/C]
TTGTAGGCCGACGTCGCCGTATATTCACCGTGGCTAGTGAGCTTCCACACTATCTTGTCCTCCTCATTCTCTGTGAAATGTACGTTGTGCACCGCACTCC
GGAGTGCGGTGCACAACGTACATTTCACAGAGAATGAGGAGGACAAGATAGTGTGGAAGCTCACTAGCCACGGTGAATATACGGCGACGTCGGCCTACAA[A/G]
GCGCAGCTCCTAGGTACTACTGCCACCAACTTCAACATCCTAATATGGAAGCCTTGGGCACCGCGCAAGTGCAAGACCTTTGCCTGGTTGATCATCCAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.00% | 5.30% | 1.57% | 30.13% | NA |
| All Indica | 2759 | 56.00% | 7.50% | 2.28% | 34.14% | NA |
| All Japonica | 1512 | 68.50% | 2.20% | 0.40% | 28.90% | NA |
| Aus | 269 | 91.40% | 0.70% | 0.00% | 7.81% | NA |
| Indica I | 595 | 77.80% | 0.70% | 2.02% | 19.50% | NA |
| Indica II | 465 | 37.00% | 4.30% | 3.01% | 55.70% | NA |
| Indica III | 913 | 45.50% | 15.10% | 2.63% | 36.80% | NA |
| Indica Intermediate | 786 | 63.10% | 5.90% | 1.65% | 29.39% | NA |
| Temperate Japonica | 767 | 60.90% | 0.30% | 0.52% | 38.33% | NA |
| Tropical Japonica | 504 | 74.60% | 5.40% | 0.40% | 19.64% | NA |
| Japonica Intermediate | 241 | 79.70% | 2.10% | 0.00% | 18.26% | NA |
| VI/Aromatic | 96 | 93.80% | 2.10% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 3.30% | 1.11% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104422091 | T -> DEL | LOC_Os11g08390.1 | N | frameshift_variant | Average:13.634; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg1104422091 | T -> C | LOC_Os11g08390.1 | synonymous_variant ; p.Lys426Lys; LOW | synonymous_codon | Average:13.634; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104422091 | NA | 2.43E-07 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422091 | NA | 4.52E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422091 | 1.47E-07 | 1.49E-10 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422091 | 2.06E-09 | 2.06E-09 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422091 | NA | 7.19E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422091 | NA | 2.25E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104422091 | NA | 4.48E-08 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |