\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104406635:

Variant ID: vg1104406635 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4406635
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCACCAACCACTCTTTTGCTTGCCGGCGCCGCGGATGATTTCGACCTCGACTTGGTGCATGCATGCCCGACTCCGTTTGCAGTGGTGCATGCCAAGGC[G/A]
TACGTCGTCCTTGTCCGATTCTCACATCCTGATCGAATCGAGCATCATCCATATATCGATGGGTTAATCTCCCTGATCCGAGCCATATATAGCTAGCTCT

Reverse complement sequence

AGAGCTAGCTATATATGGCTCGGATCAGGGAGATTAACCCATCGATATATGGATGATGCTCGATTCGATCAGGATGTGAGAATCGGACAAGGACGACGTA[C/T]
GCCTTGGCATGCACCACTGCAAACGGAGTCGGGCATGCATGCACCAAGTCGAGGTCGAAATCATCCGCGGCGCCGGCAAGCAAAAGAGTGGTTGGTGAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 39.40% 0.06% 0.00% NA
All Indica  2759 42.40% 57.50% 0.11% 0.00% NA
All Japonica  1512 90.60% 9.40% 0.00% 0.00% NA
Aus  269 69.10% 30.90% 0.00% 0.00% NA
Indica I  595 46.70% 53.30% 0.00% 0.00% NA
Indica II  465 77.60% 22.40% 0.00% 0.00% NA
Indica III  913 26.80% 73.10% 0.11% 0.00% NA
Indica Intermediate  786 36.30% 63.50% 0.25% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 75.40% 24.60% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104406635 G -> A LOC_Os11g08360.1 upstream_gene_variant ; 2967.0bp to feature; MODIFIER silent_mutation Average:73.931; most accessible tissue: Zhenshan97 root, score: 88.551 N N N N
vg1104406635 G -> A LOC_Os11g08340.1 downstream_gene_variant ; 3113.0bp to feature; MODIFIER silent_mutation Average:73.931; most accessible tissue: Zhenshan97 root, score: 88.551 N N N N
vg1104406635 G -> A LOC_Os11g08350.1 downstream_gene_variant ; 1944.0bp to feature; MODIFIER silent_mutation Average:73.931; most accessible tissue: Zhenshan97 root, score: 88.551 N N N N
vg1104406635 G -> A LOC_Os11g08340-LOC_Os11g08350 intergenic_region ; MODIFIER silent_mutation Average:73.931; most accessible tissue: Zhenshan97 root, score: 88.551 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1104406635 G A -0.01 0.0 -0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104406635 NA 6.70E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 1.86E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 6.37E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 4.00E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 4.42E-06 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 4.99E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 7.27E-07 NA mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 4.71E-06 1.18E-09 mr1457 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 5.40E-06 mr1549 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 2.20E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 3.57E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 1.55E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 7.79E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 1.20E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 4.17E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 1.94E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104406635 NA 2.30E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251