\
| Variant ID: vg1104366840 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4366840 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACGCCACCACTGCGCCCTCTCTTTGCAAGCAGGCGTCGCTGCCGCCTCCCTTCACGCATCACCGTCTCCTCCCTCCCCGTGCTGCCGCCGCCGCTGGTT[G/A]
CGCTGCAAGAGAGGCCAGAGAAGACGAGAAGGGAGGTCGGGAGATGAGTGAGAGGATAGTGTTGAAGATTTGAAGTGAAGTGTATTGAGGATCAGTTTGA
TCAAACTGATCCTCAATACACTTCACTTCAAATCTTCAACACTATCCTCTCACTCATCTCCCGACCTCCCTTCTCGTCTTCTCTGGCCTCTCTTGCAGCG[C/T]
AACCAGCGGCGGCGGCAGCACGGGGAGGGAGGAGACGGTGATGCGTGAAGGGAGGCGGCAGCGACGCCTGCTTGCAAAGAGAGGGCGCAGTGGTGGCGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.20% | 9.60% | 0.06% | 0.17% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.00% | 0.07% | NA |
| All Japonica | 1512 | 73.50% | 26.10% | 0.13% | 0.26% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 0.90% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 97.10% | 2.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 42.50% | 56.70% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 63.50% | 36.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 57.30% | 41.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104366840 | G -> A | LOC_Os11g08285-LOC_Os11g08290 | intergenic_region ; MODIFIER | silent_mutation | Average:59.928; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg1104366840 | G -> DEL | N | N | silent_mutation | Average:59.928; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104366840 | 3.48E-06 | NA | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 3.94E-07 | NA | mr1023 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 2.69E-06 | NA | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | NA | 7.70E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | NA | 3.03E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 5.67E-06 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 2.13E-09 | NA | mr1132 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 8.33E-06 | 2.92E-10 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 2.08E-06 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 8.41E-06 | NA | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 1.41E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | NA | 8.79E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 8.67E-07 | NA | mr1390 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 1.16E-06 | NA | mr1490 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 5.25E-06 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | NA | 2.37E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 8.70E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | NA | 7.60E-07 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 1.05E-08 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 3.76E-09 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | NA | 3.61E-06 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 2.04E-08 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | NA | 3.21E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | 4.62E-06 | 2.11E-10 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104366840 | NA | 1.89E-06 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |