\
| Variant ID: vg1104364656 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4364656 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 227. )
ATCGAGGTCCCTAAACTTGGTCTATTATATCATCCCGGTCTAAAATATCATTTGACTGTGGTCTTGCCTACGTGGCACGCCATTTAGACGCAATGTAGAT[G/A]
ATGACATGGCACATTATTATTATTTTTTCTTTTTTTCTCCCTTCTTCTTCCTCTTTCATTTCTCTCTTCTTTGGCCTCTTCCTCGACAGCAGCGACGCTC
GAGCGTCGCTGCTGTCGAGGAAGAGGCCAAAGAAGAGAGAAATGAAAGAGGAAGAAGAAGGGAGAAAAAAAGAAAAAATAATAATAATGTGCCATGTCAT[C/T]
ATCTACATTGCGTCTAAATGGCGTGCCACGTAGGCAAGACCACAGTCAAATGATATTTTAGACCGGGATGATATAATAGACCAAGTTTAGGGACCTCGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 9.90% | 0.00% | 0.23% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.00% | 0.07% | NA |
| All Japonica | 1512 | 73.40% | 26.20% | 0.00% | 0.40% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 0.90% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 42.30% | 56.70% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 63.10% | 36.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 44.80% | 54.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104364656 | G -> A | LOC_Os11g08285-LOC_Os11g08290 | intergenic_region ; MODIFIER | silent_mutation | Average:47.411; most accessible tissue: Zhenshan97 flower, score: 82.359 | N | N | N | N |
| vg1104364656 | G -> DEL | N | N | silent_mutation | Average:47.411; most accessible tissue: Zhenshan97 flower, score: 82.359 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104364656 | 2.04E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 8.63E-06 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | NA | 8.07E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 1.87E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | NA | 4.67E-08 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 6.90E-08 | NA | mr1107 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 9.14E-06 | NA | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 5.95E-07 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | NA | 5.97E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 3.63E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 4.57E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | NA | 3.39E-07 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 1.02E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | NA | 7.60E-07 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 3.51E-09 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 2.91E-11 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | NA | 1.64E-07 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 1.44E-08 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | NA | 2.33E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | 7.43E-06 | 2.92E-10 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104364656 | NA | 2.51E-06 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |