\
| Variant ID: vg1104325526 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4325526 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATGACTGGGCTCTCAGCCCCGCCGGAGCCTACTGCAAGGATGGCTCCGGCAATGTCAGGGACAGCTGCTGCTGCCGTCCCAATGCGACCGTCGCCGTCG[A/T]
CGACGACGTCGACCACCATCGCCGTATCCACCTTCACCAGCTCGATCTCCGTCGTTGATCGTTGATTGATTACGTACTACCTGAGTGATGATGGACGTGG
CCACGTCCATCATCACTCAGGTAGTACGTAATCAATCAACGATCAACGACGGAGATCGAGCTGGTGAAGGTGGATACGGCGATGGTGGTCGACGTCGTCG[T/A]
CGACGGCGACGGTCGCATTGGGACGGCAGCAGCAGCTGTCCCTGACATTGCCGGAGCCATCCTTGCAGTAGGCTCCGGCGGGGCTGAGAGCCCAGTCATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.80% | 0.50% | 6.58% | 4.13% | NA |
| All Indica | 2759 | 83.00% | 0.80% | 9.64% | 6.56% | NA |
| All Japonica | 1512 | 98.10% | 0.00% | 1.39% | 0.53% | NA |
| Aus | 269 | 91.80% | 0.40% | 6.32% | 1.49% | NA |
| Indica I | 595 | 97.30% | 0.70% | 1.68% | 0.34% | NA |
| Indica II | 465 | 67.10% | 1.50% | 18.92% | 12.47% | NA |
| Indica III | 913 | 86.20% | 0.30% | 8.21% | 5.26% | NA |
| Indica Intermediate | 786 | 78.00% | 0.90% | 11.83% | 9.29% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 95.40% | 0.00% | 3.37% | 1.19% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 1.10% | 6.67% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104325526 | A -> T | LOC_Os11g08230.1 | missense_variant ; p.Val7Asp; MODERATE | nonsynonymous_codon ; V7D | Average:60.027; most accessible tissue: Minghui63 panicle, score: 74.563 | unknown | unknown | DELETERIOUS | 0.00 |
| vg1104325526 | A -> T | LOC_Os11g08235.1 | missense_variant ; p.Asp129Val; MODERATE | nonsynonymous_codon ; D129V | Average:60.027; most accessible tissue: Minghui63 panicle, score: 74.563 | unknown | unknown | TOLERATED | 0.22 |
| vg1104325526 | A -> DEL | LOC_Os11g08230.1 | N | frameshift_variant | Average:60.027; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg1104325526 | A -> DEL | LOC_Os11g08235.1 | N | frameshift_variant | Average:60.027; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104325526 | 8.20E-06 | NA | mr1127 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104325526 | 2.84E-08 | 1.59E-10 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104325526 | NA | 6.41E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104325526 | NA | 1.25E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104325526 | NA | 9.48E-06 | mr1622 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104325526 | 3.75E-17 | 1.04E-55 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104325526 | 3.40E-10 | 2.79E-13 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104325526 | NA | 2.93E-07 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104325526 | 9.82E-07 | 5.27E-06 | mr1695 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104325526 | NA | 5.15E-09 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104325526 | NA | 3.48E-09 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |