| Variant ID: vg1104316593 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4316593 |
| Reference Allele: A | Alternative Allele: T,G |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, T: 0.01, others allele: 0.00, population size: 94. )
ACTGCGCAATTGAATGCCCATAACCTTCAGTACATGTATTCCTATATTATTCTTGTGTTTTTTTTGGCTCATGTGATTCGGAAATCATGTTAACCGAACA[A/T,G]
ACCCTGAAATGTGCCACGGGATCATAGTTGGGTCGTCCTTCAATTGTTAATTTCTAGCCAATCTCTTCAATCGATGTCGTTTTTCTCGTACAGTGCACAC
GTGTGCACTGTACGAGAAAAACGACATCGATTGAAGAGATTGGCTAGAAATTAACAATTGAAGGACGACCCAACTATGATCCCGTGGCACATTTCAGGGT[T/A,C]
TGTTCGGTTAACATGATTTCCGAATCACATGAGCCAAAAAAAACACAAGAATAATATAGGAATACATGTACTGAAGGTTATGGGCATTCAATTGCGCAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 38.60% | 0.47% | 0.28% | G: 0.02% |
| All Indica | 2759 | 88.60% | 10.60% | 0.47% | 0.36% | NA |
| All Japonica | 1512 | 11.50% | 87.80% | 0.46% | 0.20% | NA |
| Aus | 269 | 42.40% | 57.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.30% | 19.80% | 0.67% | 0.17% | NA |
| Indica II | 465 | 94.40% | 4.50% | 0.43% | 0.65% | NA |
| Indica III | 913 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.80% | 9.50% | 0.89% | 0.76% | NA |
| Temperate Japonica | 767 | 1.20% | 98.40% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 29.20% | 69.80% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.50% | 91.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 88.50% | 10.40% | 0.00% | 0.00% | G: 1.04% |
| Intermediate | 90 | 54.40% | 43.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104316593 | A -> T | LOC_Os11g08220.1 | downstream_gene_variant ; 977.0bp to feature; MODIFIER | silent_mutation | Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 | N | N | N | N |
| vg1104316593 | A -> T | LOC_Os11g08225.1 | downstream_gene_variant ; 2161.0bp to feature; MODIFIER | silent_mutation | Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 | N | N | N | N |
| vg1104316593 | A -> T | LOC_Os11g08230.1 | downstream_gene_variant ; 2603.0bp to feature; MODIFIER | silent_mutation | Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 | N | N | N | N |
| vg1104316593 | A -> T | LOC_Os11g08220-LOC_Os11g08225 | intergenic_region ; MODIFIER | silent_mutation | Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 | N | N | N | N |
| vg1104316593 | A -> DEL | N | N | silent_mutation | Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 | N | N | N | N |
| vg1104316593 | A -> G | LOC_Os11g08220.1 | downstream_gene_variant ; 977.0bp to feature; MODIFIER | silent_mutation | Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 | N | N | N | N |
| vg1104316593 | A -> G | LOC_Os11g08225.1 | downstream_gene_variant ; 2161.0bp to feature; MODIFIER | silent_mutation | Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 | N | N | N | N |
| vg1104316593 | A -> G | LOC_Os11g08230.1 | downstream_gene_variant ; 2603.0bp to feature; MODIFIER | silent_mutation | Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 | N | N | N | N |
| vg1104316593 | A -> G | LOC_Os11g08220-LOC_Os11g08225 | intergenic_region ; MODIFIER | silent_mutation | Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104316593 | NA | 5.79E-06 | mr1214 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | 2.84E-08 | 1.59E-10 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | NA | 5.45E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | 5.82E-06 | 3.24E-06 | mr1574 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | NA | 6.41E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | NA | 5.91E-09 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | NA | 9.48E-06 | mr1622 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | 5.86E-06 | 2.81E-07 | mr1633 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | 7.07E-15 | 1.60E-52 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | 2.87E-08 | 7.59E-11 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | NA | 2.93E-07 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | NA | 8.53E-06 | mr1732 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | NA | 4.05E-06 | mr1963 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | NA | 5.15E-09 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104316593 | NA | 3.48E-09 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |