\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104316593:

Variant ID: vg1104316593 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4316593
Reference Allele: AAlternative Allele: T,G
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, T: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGCGCAATTGAATGCCCATAACCTTCAGTACATGTATTCCTATATTATTCTTGTGTTTTTTTTGGCTCATGTGATTCGGAAATCATGTTAACCGAACA[A/T,G]
ACCCTGAAATGTGCCACGGGATCATAGTTGGGTCGTCCTTCAATTGTTAATTTCTAGCCAATCTCTTCAATCGATGTCGTTTTTCTCGTACAGTGCACAC

Reverse complement sequence

GTGTGCACTGTACGAGAAAAACGACATCGATTGAAGAGATTGGCTAGAAATTAACAATTGAAGGACGACCCAACTATGATCCCGTGGCACATTTCAGGGT[T/A,C]
TGTTCGGTTAACATGATTTCCGAATCACATGAGCCAAAAAAAACACAAGAATAATATAGGAATACATGTACTGAAGGTTATGGGCATTCAATTGCGCAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 38.60% 0.47% 0.28% G: 0.02%
All Indica  2759 88.60% 10.60% 0.47% 0.36% NA
All Japonica  1512 11.50% 87.80% 0.46% 0.20% NA
Aus  269 42.40% 57.60% 0.00% 0.00% NA
Indica I  595 79.30% 19.80% 0.67% 0.17% NA
Indica II  465 94.40% 4.50% 0.43% 0.65% NA
Indica III  913 91.50% 8.50% 0.00% 0.00% NA
Indica Intermediate  786 88.80% 9.50% 0.89% 0.76% NA
Temperate Japonica  767 1.20% 98.40% 0.26% 0.13% NA
Tropical Japonica  504 29.20% 69.80% 0.79% 0.20% NA
Japonica Intermediate  241 7.50% 91.70% 0.41% 0.41% NA
VI/Aromatic  96 88.50% 10.40% 0.00% 0.00% G: 1.04%
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104316593 A -> T LOC_Os11g08220.1 downstream_gene_variant ; 977.0bp to feature; MODIFIER silent_mutation Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 N N N N
vg1104316593 A -> T LOC_Os11g08225.1 downstream_gene_variant ; 2161.0bp to feature; MODIFIER silent_mutation Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 N N N N
vg1104316593 A -> T LOC_Os11g08230.1 downstream_gene_variant ; 2603.0bp to feature; MODIFIER silent_mutation Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 N N N N
vg1104316593 A -> T LOC_Os11g08220-LOC_Os11g08225 intergenic_region ; MODIFIER silent_mutation Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 N N N N
vg1104316593 A -> DEL N N silent_mutation Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 N N N N
vg1104316593 A -> G LOC_Os11g08220.1 downstream_gene_variant ; 977.0bp to feature; MODIFIER silent_mutation Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 N N N N
vg1104316593 A -> G LOC_Os11g08225.1 downstream_gene_variant ; 2161.0bp to feature; MODIFIER silent_mutation Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 N N N N
vg1104316593 A -> G LOC_Os11g08230.1 downstream_gene_variant ; 2603.0bp to feature; MODIFIER silent_mutation Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 N N N N
vg1104316593 A -> G LOC_Os11g08220-LOC_Os11g08225 intergenic_region ; MODIFIER silent_mutation Average:48.241; most accessible tissue: Minghui63 flower, score: 62.529 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104316593 NA 5.79E-06 mr1214 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 2.84E-08 1.59E-10 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 NA 5.45E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 5.82E-06 3.24E-06 mr1574 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 NA 6.41E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 NA 5.91E-09 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 NA 9.48E-06 mr1622 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 5.86E-06 2.81E-07 mr1633 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 7.07E-15 1.60E-52 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 2.87E-08 7.59E-11 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 NA 2.93E-07 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 NA 8.53E-06 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 NA 4.05E-06 mr1963 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 NA 5.15E-09 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104316593 NA 3.48E-09 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251