Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104315941:

Variant ID: vg1104315941 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4315941
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCCACTGAAACCAAAAGTTGAGAGCTTCAAGTAGATTTGATTTTCAAACCTTTGGTACGACTAGAAGCCTTGCTTATTCAAGAAGAGTAGTAAGACCTT[A/G]
AAATGAAGAGTATTCTTCTCCTCACTTGAGTCAATGTGAGGTGAAGAGAACTAGAAAAACACACGAGTACGCTTGCTCGTCTCGACTGGCTAAGCCAGGC

Reverse complement sequence

GCCTGGCTTAGCCAGTCGAGACGAGCAAGCGTACTCGTGTGTTTTTCTAGTTCTCTTCACCTCACATTGACTCAAGTGAGGAGAAGAATACTCTTCATTT[T/C]
AAGGTCTTACTACTCTTCTTGAATAAGCAAGGCTTCTAGTCGTACCAAAGGTTTGAAAATCAAATCTACTTGAAGCTCTCAACTTTTGGTTTCAGTGGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.50%	49.40%	0.13%	0.02%	NA
All Indica	2759	73.30%	26.50%	0.18%	0.04%	NA
All Japonica	1512	11.30%	88.70%	0.00%	0.00%	NA
Aus	269	23.80%	76.20%	0.00%	0.00%	NA
Indica I	595	64.70%	34.80%	0.34%	0.17%	NA
Indica II	465	91.60%	8.20%	0.22%	0.00%	NA
Indica III	913	68.00%	31.90%	0.11%	0.00%	NA
Indica Intermediate	786	75.10%	24.80%	0.13%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	29.00%	71.00%	0.00%	0.00%	NA
Japonica Intermediate	241	7.50%	92.50%	0.00%	0.00%	NA
VI/Aromatic	96	85.40%	13.50%	1.04%	0.00%	NA
Intermediate	90	51.10%	48.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104315941	A -> DEL	N	N	silent_mutation	Average:54.75; most accessible tissue: Callus, score: 72.821	N	N	N	N
vg1104315941	A -> G	LOC_Os11g08220.1	downstream_gene_variant ; 325.0bp to feature; MODIFIER	silent_mutation	Average:54.75; most accessible tissue: Callus, score: 72.821	N	N	N	N
vg1104315941	A -> G	LOC_Os11g08225.1	downstream_gene_variant ; 2813.0bp to feature; MODIFIER	silent_mutation	Average:54.75; most accessible tissue: Callus, score: 72.821	N	N	N	N
vg1104315941	A -> G	LOC_Os11g08230.1	downstream_gene_variant ; 3255.0bp to feature; MODIFIER	silent_mutation	Average:54.75; most accessible tissue: Callus, score: 72.821	N	N	N	N
vg1104315941	A -> G	LOC_Os11g08220-LOC_Os11g08225	intergenic_region ; MODIFIER	silent_mutation	Average:54.75; most accessible tissue: Callus, score: 72.821	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104315941	5.45E-07	3.89E-07	mr1127	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	9.76E-06	4.26E-07	mr1181	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	2.12E-08	1.24E-10	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	NA	2.72E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	4.82E-06	6.43E-06	mr1363	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	7.41E-06	7.41E-06	mr1429	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	NA	8.79E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	4.55E-06	4.55E-06	mr1452	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	NA	7.86E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	3.78E-06	3.78E-06	mr1513	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	NA	3.62E-06	mr1522	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	4.40E-06	1.76E-06	mr1574	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	NA	4.78E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	NA	9.04E-08	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	NA	6.94E-06	mr1622	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	5.84E-20	4.00E-59	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	5.67E-12	1.81E-14	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	2.48E-06	1.13E-08	mr1638	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	7.65E-06	7.65E-06	mr1947	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	4.22E-06	4.22E-06	mr1964	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	7.69E-06	1.16E-06	mr1981	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	NA	2.92E-07	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104315941	NA	9.76E-08	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251