Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1104298838:

Variant ID: vg1104298838 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4298838
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.36, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAAAATAAACACAAAGTCATGGCCGATGACGCCCTTTTTATATCAATATGGTTCAATAGTAGCATGCATGACATATCCCAACAGCTGCATAAATGGAT[C/T]
CAGCACCAACAGATTTAACACATAATCCCAAATTACCAGAAAGGCAAAAAGTAAGCAACAAAACTAGCTATTAATTAATAACTACCATTTGCCATGCTCG

Reverse complement sequence

CGAGCATGGCAAATGGTAGTTATTAATTAATAGCTAGTTTTGTTGCTTACTTTTTGCCTTTCTGGTAATTTGGGATTATGTGTTAAATCTGTTGGTGCTG[G/A]
ATCCATTTATGCAGCTGTTGGGATATGTCATGCATGCTACTATTGAACCATATTGATATAAAAAGGGCGTCATCGGCCATGACTTTGTGTTTATTTTTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.60%	38.20%	0.28%	0.02%	NA
All Indica	2759	89.70%	10.00%	0.22%	0.00%	NA
All Japonica	1512	11.50%	88.10%	0.33%	0.07%	NA
Aus	269	42.80%	57.20%	0.00%	0.00%	NA
Indica I	595	80.70%	19.00%	0.34%	0.00%	NA
Indica II	465	95.90%	3.90%	0.22%	0.00%	NA
Indica III	913	91.80%	8.10%	0.11%	0.00%	NA
Indica Intermediate	786	90.60%	9.20%	0.25%	0.00%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	29.00%	70.00%	0.79%	0.20%	NA
Japonica Intermediate	241	7.90%	91.70%	0.41%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	65.60%	32.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104298838	C -> T	LOC_Os11g08200.1	downstream_gene_variant ; 1157.0bp to feature; MODIFIER	silent_mutation	Average:88.706; most accessible tissue: Zhenshan97 flag leaf, score: 98.875	N	N	N	N
vg1104298838	C -> T	LOC_Os11g08210.1	downstream_gene_variant ; 311.0bp to feature; MODIFIER	silent_mutation	Average:88.706; most accessible tissue: Zhenshan97 flag leaf, score: 98.875	N	N	N	N
vg1104298838	C -> T	LOC_Os11g08200-LOC_Os11g08210	intergenic_region ; MODIFIER	silent_mutation	Average:88.706; most accessible tissue: Zhenshan97 flag leaf, score: 98.875	N	N	N	N
vg1104298838	C -> DEL	N	N	silent_mutation	Average:88.706; most accessible tissue: Zhenshan97 flag leaf, score: 98.875	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1104298838	C	T	-0.08	-0.05	0.01	-0.03	-0.06	-0.08

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104298838	NA	8.91E-06	mr1127	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	3.66E-09	4.86E-11	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	3.33E-06	4.45E-06	mr1296	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	NA	9.09E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	NA	4.75E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	NA	9.15E-07	mr1522	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	NA	2.97E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	NA	1.02E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	1.99E-24	8.99E-65	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	9.94E-14	1.36E-16	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	1.04E-06	5.64E-09	mr1638	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	NA	6.83E-08	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104298838	NA	1.35E-07	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251