Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104258287:

Variant ID: vg1104258287 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4258287
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGGCATCTACAACAACGTTTATTAATAGGCTCTCTTGGTTGGCATAGAAGTAAATTTGATGATGTGGAAGAGAGAGAGAGGAGAGAAAAGGAAAGCATC[A/G]
TTGCTACGCATGACAATGGAGTCTACTCTTAACATTTATTAAAGAAAATTCTGTCGCATGAGGGAGAAGAAAAGGAAATAAGGGAAATAAAAAAATGTTT

Reverse complement sequence

AAACATTTTTTTATTTCCCTTATTTCCTTTTCTTCTCCCTCATGCGACAGAATTTTCTTTAATAAATGTTAAGAGTAGACTCCATTGTCATGCGTAGCAA[T/C]
GATGCTTTCCTTTTCTCTCCTCTCTCTCTCTTCCACATCATCAAATTTACTTCTATGCCAACCAAGAGAGCCTATTAATAAACGTTGTTGTAGATGCCCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	6.80%	1.23%	53.07%	NA
All Indica	2759	10.90%	9.70%	1.38%	78.00%	NA
All Japonica	1512	88.60%	1.50%	0.26%	9.72%	NA
Aus	269	57.60%	3.70%	1.86%	36.80%	NA
Indica I	595	20.50%	5.00%	0.67%	73.78%	NA
Indica II	465	5.20%	10.30%	2.58%	81.94%	NA
Indica III	913	8.40%	12.40%	1.20%	77.98%	NA
Indica Intermediate	786	9.80%	9.90%	1.40%	78.88%	NA
Temperate Japonica	767	98.80%	0.00%	0.26%	0.91%	NA
Tropical Japonica	504	71.00%	4.40%	0.40%	24.21%	NA
Japonica Intermediate	241	92.50%	0.00%	0.00%	7.47%	NA
VI/Aromatic	96	12.50%	12.50%	6.25%	68.75%	NA
Intermediate	90	37.80%	7.80%	5.56%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104258287	A -> DEL	N	N	silent_mutation	Average:32.184; most accessible tissue: Callus, score: 70.464	N	N	N	N
vg1104258287	A -> G	LOC_Os11g08120.1	upstream_gene_variant ; 4621.0bp to feature; MODIFIER	silent_mutation	Average:32.184; most accessible tissue: Callus, score: 70.464	N	N	N	N
vg1104258287	A -> G	LOC_Os11g08110.1	downstream_gene_variant ; 2340.0bp to feature; MODIFIER	silent_mutation	Average:32.184; most accessible tissue: Callus, score: 70.464	N	N	N	N
vg1104258287	A -> G	LOC_Os11g08110.2	downstream_gene_variant ; 2340.0bp to feature; MODIFIER	silent_mutation	Average:32.184; most accessible tissue: Callus, score: 70.464	N	N	N	N
vg1104258287	A -> G	LOC_Os11g08110-LOC_Os11g08120	intergenic_region ; MODIFIER	silent_mutation	Average:32.184; most accessible tissue: Callus, score: 70.464	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104258287	9.62E-06	1.72E-06	mr1127	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	2.12E-08	1.24E-10	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	3.95E-06	3.95E-06	mr1276	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	NA	3.96E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	9.78E-06	9.78E-06	mr1513	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	NA	4.20E-06	mr1522	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	NA	4.78E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	NA	1.16E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	NA	6.94E-06	mr1622	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	2.04E-19	1.94E-59	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	5.20E-11	8.72E-14	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	2.48E-06	1.13E-08	mr1638	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	NA	8.48E-06	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	6.12E-06	1.28E-06	mr1963	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	8.71E-07	1.05E-07	mr1981	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	NA	2.92E-07	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258287	NA	9.76E-08	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251