Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104258278:

Variant ID: vg1104258278 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4258278
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CACGCATTTAGGGCATCTACAACAACGTTTATTAATAGGCTCTCTTGGTTGGCATAGAAGTAAATTTGATGATGTGGAAGAGAGAGAGAGGAGAGAAAAG[G/A]
AAAGCATCATTGCTACGCATGACAATGGAGTCTACTCTTAACATTTATTAAAGAAAATTCTGTCGCATGAGGGAGAAGAAAAGGAAATAAGGGAAATAAA

Reverse complement sequence

TTTATTTCCCTTATTTCCTTTTCTTCTCCCTCATGCGACAGAATTTTCTTTAATAAATGTTAAGAGTAGACTCCATTGTCATGCGTAGCAATGATGCTTT[C/T]
CTTTTCTCTCCTCTCTCTCTCTTCCACATCATCAAATTTACTTCTATGCCAACCAAGAGAGCCTATTAATAAACGTTGTTGTAGATGCCCTAAATGCGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	7.00%	0.87%	53.07%	NA
All Indica	2759	11.00%	10.20%	0.83%	77.96%	NA
All Japonica	1512	88.60%	1.40%	0.33%	9.72%	NA
Aus	269	58.00%	4.10%	1.12%	36.80%	NA
Indica I	595	20.50%	5.00%	0.67%	73.78%	NA
Indica II	465	5.80%	10.80%	1.51%	81.94%	NA
Indica III	913	8.40%	12.90%	0.66%	77.98%	NA
Indica Intermediate	786	9.90%	10.60%	0.76%	78.75%	NA
Temperate Japonica	767	98.80%	0.00%	0.26%	0.91%	NA
Tropical Japonica	504	71.00%	4.20%	0.60%	24.21%	NA
Japonica Intermediate	241	92.50%	0.00%	0.00%	7.47%	NA
VI/Aromatic	96	12.50%	12.50%	5.21%	69.79%	NA
Intermediate	90	37.80%	7.80%	5.56%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104258278	G -> A	LOC_Os11g08120.1	upstream_gene_variant ; 4630.0bp to feature; MODIFIER	silent_mutation	Average:32.686; most accessible tissue: Callus, score: 70.464	N	N	N	N
vg1104258278	G -> A	LOC_Os11g08110.1	downstream_gene_variant ; 2331.0bp to feature; MODIFIER	silent_mutation	Average:32.686; most accessible tissue: Callus, score: 70.464	N	N	N	N
vg1104258278	G -> A	LOC_Os11g08110.2	downstream_gene_variant ; 2331.0bp to feature; MODIFIER	silent_mutation	Average:32.686; most accessible tissue: Callus, score: 70.464	N	N	N	N
vg1104258278	G -> A	LOC_Os11g08110-LOC_Os11g08120	intergenic_region ; MODIFIER	silent_mutation	Average:32.686; most accessible tissue: Callus, score: 70.464	N	N	N	N
vg1104258278	G -> DEL	N	N	silent_mutation	Average:32.686; most accessible tissue: Callus, score: 70.464	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104258278	9.07E-06	1.59E-06	mr1127	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	2.12E-08	1.24E-10	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	3.98E-06	3.98E-06	mr1276	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	NA	3.84E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	NA	4.45E-06	mr1522	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	NA	4.78E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	NA	9.38E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	NA	6.94E-06	mr1622	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	7.79E-20	6.90E-60	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	4.08E-11	6.88E-14	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	2.48E-06	1.13E-08	mr1638	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	NA	8.88E-06	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	5.97E-06	1.16E-06	mr1963	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	8.81E-07	1.07E-07	mr1981	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	NA	2.92E-07	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104258278	NA	9.76E-08	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251