\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104256046:

Variant ID: vg1104256046 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4256046
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAACAAAAGAAAATGCAAATATTTAACTTTCTGATGACCTGTAAAAGATAATGCAGATACTTTATTTAAATTTCAGCATATCTGTCCGTTTATTTGTCT[G/A]
TCTATCTGTCTTTACAGAAGTGCTTTTCTGATGAGTGATGGCACGCACAAGAAAATGCAGATATTTTATTTAAATATCTTCATCTATTGATTTATCTATA

Reverse complement sequence

TATAGATAAATCAATAGATGAAGATATTTAAATAAAATATCTGCATTTTCTTGTGCGTGCCATCACTCATCAGAAAAGCACTTCTGTAAAGACAGATAGA[C/T]
AGACAAATAAACGGACAGATATGCTGAAATTTAAATAAAGTATCTGCATTATCTTTTACAGGTCATCAGAAAGTTAAATATTTGCATTTTCTTTTGTTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 0.20% 15.55% 5.04% NA
All Indica  2759 69.40% 0.30% 23.05% 7.25% NA
All Japonica  1512 95.80% 0.00% 2.91% 1.32% NA
Aus  269 90.70% 0.00% 7.43% 1.86% NA
Indica I  595 61.70% 0.20% 34.62% 3.53% NA
Indica II  465 61.30% 0.40% 28.17% 10.11% NA
Indica III  913 80.60% 0.20% 12.16% 7.01% NA
Indica Intermediate  786 67.20% 0.30% 23.92% 8.65% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 89.50% 0.00% 7.34% 3.17% NA
Japonica Intermediate  241 96.30% 0.00% 2.49% 1.24% NA
VI/Aromatic  96 70.80% 1.00% 16.67% 11.46% NA
Intermediate  90 76.70% 0.00% 21.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104256046 G -> A LOC_Os11g08100.1 downstream_gene_variant ; 4040.0bp to feature; MODIFIER silent_mutation Average:48.218; most accessible tissue: Callus, score: 88.329 N N N N
vg1104256046 G -> A LOC_Os11g08110.1 downstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:48.218; most accessible tissue: Callus, score: 88.329 N N N N
vg1104256046 G -> A LOC_Os11g08110.2 downstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:48.218; most accessible tissue: Callus, score: 88.329 N N N N
vg1104256046 G -> A LOC_Os11g08110-LOC_Os11g08120 intergenic_region ; MODIFIER silent_mutation Average:48.218; most accessible tissue: Callus, score: 88.329 N N N N
vg1104256046 G -> DEL N N silent_mutation Average:48.218; most accessible tissue: Callus, score: 88.329 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104256046 2.12E-08 1.24E-10 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046 3.29E-06 3.36E-07 mr1571 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046 NA 4.78E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046 NA 6.94E-06 mr1622 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046 1.21E-19 1.30E-58 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046 1.90E-10 7.97E-13 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046 2.48E-06 1.13E-08 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046 NA 2.92E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046 NA 9.76E-08 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251