\
| Variant ID: vg1104256046 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4256046 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCAACAAAAGAAAATGCAAATATTTAACTTTCTGATGACCTGTAAAAGATAATGCAGATACTTTATTTAAATTTCAGCATATCTGTCCGTTTATTTGTCT[G/A]
TCTATCTGTCTTTACAGAAGTGCTTTTCTGATGAGTGATGGCACGCACAAGAAAATGCAGATATTTTATTTAAATATCTTCATCTATTGATTTATCTATA
TATAGATAAATCAATAGATGAAGATATTTAAATAAAATATCTGCATTTTCTTGTGCGTGCCATCACTCATCAGAAAAGCACTTCTGTAAAGACAGATAGA[C/T]
AGACAAATAAACGGACAGATATGCTGAAATTTAAATAAAGTATCTGCATTATCTTTTACAGGTCATCAGAAAGTTAAATATTTGCATTTTCTTTTGTTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 0.20% | 15.55% | 5.04% | NA |
| All Indica | 2759 | 69.40% | 0.30% | 23.05% | 7.25% | NA |
| All Japonica | 1512 | 95.80% | 0.00% | 2.91% | 1.32% | NA |
| Aus | 269 | 90.70% | 0.00% | 7.43% | 1.86% | NA |
| Indica I | 595 | 61.70% | 0.20% | 34.62% | 3.53% | NA |
| Indica II | 465 | 61.30% | 0.40% | 28.17% | 10.11% | NA |
| Indica III | 913 | 80.60% | 0.20% | 12.16% | 7.01% | NA |
| Indica Intermediate | 786 | 67.20% | 0.30% | 23.92% | 8.65% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 89.50% | 0.00% | 7.34% | 3.17% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 2.49% | 1.24% | NA |
| VI/Aromatic | 96 | 70.80% | 1.00% | 16.67% | 11.46% | NA |
| Intermediate | 90 | 76.70% | 0.00% | 21.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104256046 | G -> A | LOC_Os11g08100.1 | downstream_gene_variant ; 4040.0bp to feature; MODIFIER | silent_mutation | Average:48.218; most accessible tissue: Callus, score: 88.329 | N | N | N | N |
| vg1104256046 | G -> A | LOC_Os11g08110.1 | downstream_gene_variant ; 99.0bp to feature; MODIFIER | silent_mutation | Average:48.218; most accessible tissue: Callus, score: 88.329 | N | N | N | N |
| vg1104256046 | G -> A | LOC_Os11g08110.2 | downstream_gene_variant ; 99.0bp to feature; MODIFIER | silent_mutation | Average:48.218; most accessible tissue: Callus, score: 88.329 | N | N | N | N |
| vg1104256046 | G -> A | LOC_Os11g08110-LOC_Os11g08120 | intergenic_region ; MODIFIER | silent_mutation | Average:48.218; most accessible tissue: Callus, score: 88.329 | N | N | N | N |
| vg1104256046 | G -> DEL | N | N | silent_mutation | Average:48.218; most accessible tissue: Callus, score: 88.329 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104256046 | 2.12E-08 | 1.24E-10 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104256046 | 3.29E-06 | 3.36E-07 | mr1571 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104256046 | NA | 4.78E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104256046 | NA | 6.94E-06 | mr1622 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104256046 | 1.21E-19 | 1.30E-58 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104256046 | 1.90E-10 | 7.97E-13 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104256046 | 2.48E-06 | 1.13E-08 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104256046 | NA | 2.92E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104256046 | NA | 9.76E-08 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |