\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104251780:

Variant ID: vg1104251780 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4251780
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGCAGTTCATGTAGTTAGACTATAGCTTCAAGATGAATGACACTGTTTGCAGAAACTACTTTGGTCTCCCTGTTTCTGGCACAGAGATGACAGAACAA[T/C]
AAAAGTGTCTTTTGGAGTGAACTAGAACTTCTGATGACTCTCACAGAAAATTCAGTACTCTTTATAGCGAAATGTCAGCCTCTATCCATCCATCTGACAT

Reverse complement sequence

ATGTCAGATGGATGGATAGAGGCTGACATTTCGCTATAAAGAGTACTGAATTTTCTGTGAGAGTCATCAGAAGTTCTAGTTCACTCCAAAAGACACTTTT[A/G]
TTGTTCTGTCATCTCTGTGCCAGAAACAGGGAGACCAAAGTAGTTTCTGCAAACAGTGTCATTCATCTTGAAGCTATAGTCTAACTACATGAACTGCTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 38.30% 0.04% 0.36% NA
All Indica  2759 89.50% 10.20% 0.04% 0.29% NA
All Japonica  1512 11.50% 88.10% 0.00% 0.40% NA
Aus  269 42.40% 57.60% 0.00% 0.00% NA
Indica I  595 80.50% 19.30% 0.00% 0.17% NA
Indica II  465 95.10% 4.10% 0.22% 0.65% NA
Indica III  913 91.60% 8.30% 0.00% 0.11% NA
Indica Intermediate  786 90.50% 9.20% 0.00% 0.38% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 29.20% 69.80% 0.00% 0.99% NA
Japonica Intermediate  241 7.50% 92.10% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 64.40% 31.10% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104251780 T -> DEL N N silent_mutation Average:71.916; most accessible tissue: Callus, score: 95.212 N N N N
vg1104251780 T -> C LOC_Os11g08100.1 3_prime_UTR_variant ; 516.0bp to feature; MODIFIER silent_mutation Average:71.916; most accessible tissue: Callus, score: 95.212 N N N N
vg1104251780 T -> C LOC_Os11g08110.1 upstream_gene_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:71.916; most accessible tissue: Callus, score: 95.212 N N N N
vg1104251780 T -> C LOC_Os11g08110.2 upstream_gene_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:71.916; most accessible tissue: Callus, score: 95.212 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1104251780 T C -0.02 -0.03 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104251780 3.96E-07 3.24E-07 mr1127 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 2.12E-08 1.24E-10 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 NA 4.78E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 NA 2.81E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 NA 6.94E-06 mr1622 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 3.61E-23 2.07E-63 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 2.91E-13 4.74E-16 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 2.48E-06 1.13E-08 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 3.18E-06 3.18E-06 mr1947 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 NA 3.71E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 NA 2.92E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 NA 4.04E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 NA 2.67E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104251780 NA 9.76E-08 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251