\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104228568:

Variant ID: vg1104228568 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4228568
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, T: 0.29, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ATACCAGGTAGGCATGTCTCCAATGATAGTGTTGTGGTGAATGATAAGTATAGCTGGTGAGGACTGAGTCTATAACTGGCTGAACTAATTGTGTCGTCAG[T/G]
CTTATGTATAATTGCCAGTAAGTAGGATCAATAAAATTCAAAACTGTAATTCATCTAGGAAGCAAGTTAGGAAACTGTAATTGATCTATGTTTGATCTGC

Reverse complement sequence

GCAGATCAAACATAGATCAATTACAGTTTCCTAACTTGCTTCCTAGATGAATTACAGTTTTGAATTTTATTGATCCTACTTACTGGCAATTATACATAAG[A/C]
CTGACGACACAATTAGTTCAGCCAGTTATAGACTCAGTCCTCACCAGCTATACTTATCATTCACCACAACACTATCATTGGAGACATGCCTACCTGGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 38.70% 2.24% 5.46% NA
All Indica  2759 77.10% 11.40% 3.33% 8.16% NA
All Japonica  1512 11.30% 87.40% 0.46% 0.86% NA
Aus  269 40.90% 57.20% 0.37% 1.49% NA
Indica I  595 68.20% 21.30% 5.21% 5.21% NA
Indica II  465 79.40% 5.80% 4.09% 10.75% NA
Indica III  913 79.70% 8.40% 1.86% 9.97% NA
Indica Intermediate  786 79.40% 10.70% 3.18% 6.74% NA
Temperate Japonica  767 0.90% 99.00% 0.00% 0.13% NA
Tropical Japonica  504 28.40% 68.50% 0.79% 2.38% NA
Japonica Intermediate  241 8.70% 90.00% 1.24% 0.00% NA
VI/Aromatic  96 83.30% 5.20% 3.12% 8.33% NA
Intermediate  90 51.10% 36.70% 3.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104228568 T -> DEL N N silent_mutation Average:59.252; most accessible tissue: Callus, score: 88.567 N N N N
vg1104228568 T -> G LOC_Os11g08090.1 upstream_gene_variant ; 4892.0bp to feature; MODIFIER silent_mutation Average:59.252; most accessible tissue: Callus, score: 88.567 N N N N
vg1104228568 T -> G LOC_Os11g08080.2 downstream_gene_variant ; 929.0bp to feature; MODIFIER silent_mutation Average:59.252; most accessible tissue: Callus, score: 88.567 N N N N
vg1104228568 T -> G LOC_Os11g08080.1 intron_variant ; MODIFIER silent_mutation Average:59.252; most accessible tissue: Callus, score: 88.567 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104228568 9.32E-07 5.46E-07 mr1127 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 NA 8.81E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 2.12E-08 1.24E-10 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 NA 9.02E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 2.99E-06 8.53E-08 mr1522 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 NA 6.62E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 NA 4.78E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 4.52E-06 4.52E-06 mr1591 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 NA 8.09E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 NA 6.94E-06 mr1622 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 1.12E-25 2.53E-67 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 6.60E-16 1.26E-19 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 2.48E-06 1.13E-08 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 3.55E-06 3.55E-06 mr1947 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 NA 9.27E-06 mr1963 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 8.05E-06 6.03E-07 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 NA 2.92E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228568 NA 9.76E-08 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251