\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104228562:

Variant ID: vg1104228562 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4228562
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CCTATAATACCAGGTAGGCATGTCTCCAATGATAGTGTTGTGGTGAATGATAAGTATAGCTGGTGAGGACTGAGTCTATAACTGGCTGAACTAATTGTGT[C/T]
GTCAGTCTTATGTATAATTGCCAGTAAGTAGGATCAATAAAATTCAAAACTGTAATTCATCTAGGAAGCAAGTTAGGAAACTGTAATTGATCTATGTTTG

Reverse complement sequence

CAAACATAGATCAATTACAGTTTCCTAACTTGCTTCCTAGATGAATTACAGTTTTGAATTTTATTGATCCTACTTACTGGCAATTATACATAAGACTGAC[G/A]
ACACAATTAGTTCAGCCAGTTATAGACTCAGTCCTCACCAGCTATACTTATCATTCACCACAACACTATCATTGGAGACATGCCTACCTGGTATTATAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 40.00% 1.46% 0.40% NA
All Indica  2759 84.50% 12.70% 2.28% 0.58% NA
All Japonica  1512 11.20% 88.60% 0.20% 0.00% NA
Aus  269 42.00% 58.00% 0.00% 0.00% NA
Indica I  595 75.60% 23.20% 0.84% 0.34% NA
Indica II  465 88.80% 8.00% 2.58% 0.65% NA
Indica III  913 88.80% 8.50% 2.19% 0.44% NA
Indica Intermediate  786 83.50% 12.30% 3.31% 0.89% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 28.20% 71.20% 0.60% 0.00% NA
Japonica Intermediate  241 7.90% 92.10% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 8.30% 3.12% 0.00% NA
Intermediate  90 56.70% 40.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104228562 C -> T LOC_Os11g08090.1 upstream_gene_variant ; 4898.0bp to feature; MODIFIER silent_mutation Average:59.149; most accessible tissue: Callus, score: 88.567 N N N N
vg1104228562 C -> T LOC_Os11g08080.2 downstream_gene_variant ; 923.0bp to feature; MODIFIER silent_mutation Average:59.149; most accessible tissue: Callus, score: 88.567 N N N N
vg1104228562 C -> T LOC_Os11g08080.1 intron_variant ; MODIFIER silent_mutation Average:59.149; most accessible tissue: Callus, score: 88.567 N N N N
vg1104228562 C -> DEL N N silent_mutation Average:59.149; most accessible tissue: Callus, score: 88.567 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104228562 1.99E-06 1.36E-06 mr1127 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 4.49E-08 4.27E-10 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 5.16E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 2.20E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 4.32E-06 1.40E-07 mr1522 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 5.10E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 6.72E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 1.30E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 9.06E-06 mr1622 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 3.45E-26 3.25E-67 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 2.83E-16 1.21E-19 mr1638 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 2.31E-06 1.24E-08 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 4.62E-06 mr1963 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 1.23E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 9.83E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 1.95E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104228562 NA 4.48E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251