\
| Variant ID: vg1104204113 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4204113 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCAGATGAGGTCGAGGGAATAGTGAAGCTCTGCACGTTATACGCATTGAGGCGTAAGGTGTCAGAAGCAACACTTCGACCTTAGGTTTGAGTTTTGTCG[G/A]
ACTTTACAACCAACGGTTCGACATCAGGTCAGAAGACCGTGCGAACGTCCCCATGGAAGGCGTAAAGTTCCAAACGGTGGTTGTTTAGTGGCGAAGGGTA
TACCCTTCGCCACTAAACAACCACCGTTTGGAACTTTACGCCTTCCATGGGGACGTTCGCACGGTCTTCTGACCTGATGTCGAACCGTTGGTTGTAAAGT[C/T]
CGACAAAACTCAAACCTAAGGTCGAAGTGTTGCTTCTGACACCTTACGCCTCAATGCGTATAACGTGCAGAGCTTCACTATTCCCTCGACCTCATCTGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.90% | 0.20% | 7.11% | 45.81% | NA |
| All Indica | 2759 | 17.40% | 0.30% | 9.13% | 73.18% | NA |
| All Japonica | 1512 | 97.90% | 0.00% | 0.20% | 1.85% | NA |
| Aus | 269 | 62.10% | 0.40% | 8.55% | 29.00% | NA |
| Indica I | 595 | 27.90% | 0.30% | 7.90% | 63.87% | NA |
| Indica II | 465 | 15.90% | 0.20% | 6.67% | 77.20% | NA |
| Indica III | 913 | 10.20% | 0.50% | 9.97% | 79.30% | NA |
| Indica Intermediate | 786 | 18.60% | 0.10% | 10.56% | 70.74% | NA |
| Temperate Japonica | 767 | 99.20% | 0.00% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 96.00% | 0.00% | 0.60% | 3.37% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 32.30% | 0.00% | 53.12% | 14.58% | NA |
| Intermediate | 90 | 63.30% | 0.00% | 7.78% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104204113 | G -> A | LOC_Os11g08060.1 | downstream_gene_variant ; 3917.0bp to feature; MODIFIER | silent_mutation | Average:10.232; most accessible tissue: Callus, score: 36.159 | N | N | N | N |
| vg1104204113 | G -> A | LOC_Os11g08050-LOC_Os11g08060 | intergenic_region ; MODIFIER | silent_mutation | Average:10.232; most accessible tissue: Callus, score: 36.159 | N | N | N | N |
| vg1104204113 | G -> DEL | N | N | silent_mutation | Average:10.232; most accessible tissue: Callus, score: 36.159 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104204113 | 3.22E-07 | NA | mr1337 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104204113 | 5.16E-07 | 5.16E-07 | mr1337 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104204113 | 3.24E-06 | 3.24E-06 | mr1487 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104204113 | NA | 2.06E-06 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104204113 | 1.03E-06 | 1.22E-06 | mr1549 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104204113 | NA | 1.29E-06 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104204113 | 8.39E-06 | 8.39E-06 | mr1572 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104204113 | 8.09E-16 | 4.47E-48 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104204113 | 1.93E-10 | 7.59E-13 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104204113 | NA | 5.53E-06 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |