\
| Variant ID: vg1104179321 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4179321 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATTTAATAACCAATTCATACAATAGTTGCTTACTATACTATTAATATATGGTCCCACCTGTTATACATACATTGTGTCTTAGAGTCCGTGCTACAGCTG[C/G]
CTACAAATCTGTAGCCCACTGCTCTTCTCTCTCATCGTTTATCTCATTAAAATATGTTTATAGCTAGCTAATAGCCTGCTATTGTACCTGCTCTTAGAAG
CTTCTAAGAGCAGGTACAATAGCAGGCTATTAGCTAGCTATAAACATATTTTAATGAGATAAACGATGAGAGAGAAGAGCAGTGGGCTACAGATTTGTAG[G/C]
CAGCTGTAGCACGGACTCTAAGACACAATGTATGTATAACAGGTGGGACCATATATTAATAGTATAGTAAGCAACTATTGTATGAATTGGTTATTAAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.00% | 7.40% | 1.63% | 59.01% | NA |
| All Indica | 2759 | 11.80% | 0.40% | 1.99% | 85.86% | NA |
| All Japonica | 1512 | 66.10% | 21.50% | 0.33% | 12.10% | NA |
| Aus | 269 | 57.20% | 1.10% | 5.20% | 36.43% | NA |
| Indica I | 595 | 21.50% | 0.00% | 2.69% | 75.80% | NA |
| Indica II | 465 | 6.70% | 0.20% | 2.37% | 90.75% | NA |
| Indica III | 913 | 9.10% | 0.10% | 0.88% | 89.92% | NA |
| Indica Intermediate | 786 | 10.60% | 1.00% | 2.54% | 85.88% | NA |
| Temperate Japonica | 767 | 96.60% | 2.30% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 15.50% | 53.40% | 0.99% | 30.16% | NA |
| Japonica Intermediate | 241 | 74.70% | 15.80% | 0.00% | 9.54% | NA |
| VI/Aromatic | 96 | 7.30% | 1.00% | 1.04% | 90.62% | NA |
| Intermediate | 90 | 30.00% | 10.00% | 2.22% | 57.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104179321 | C -> DEL | N | N | silent_mutation | Average:14.501; most accessible tissue: Callus, score: 57.995 | N | N | N | N |
| vg1104179321 | C -> G | LOC_Os11g08020.1 | upstream_gene_variant ; 4155.0bp to feature; MODIFIER | silent_mutation | Average:14.501; most accessible tissue: Callus, score: 57.995 | N | N | N | N |
| vg1104179321 | C -> G | LOC_Os11g08040.1 | downstream_gene_variant ; 3288.0bp to feature; MODIFIER | silent_mutation | Average:14.501; most accessible tissue: Callus, score: 57.995 | N | N | N | N |
| vg1104179321 | C -> G | LOC_Os11g08050.1 | downstream_gene_variant ; 4871.0bp to feature; MODIFIER | silent_mutation | Average:14.501; most accessible tissue: Callus, score: 57.995 | N | N | N | N |
| vg1104179321 | C -> G | LOC_Os11g08020-LOC_Os11g08040 | intergenic_region ; MODIFIER | silent_mutation | Average:14.501; most accessible tissue: Callus, score: 57.995 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104179321 | NA | 4.58E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104179321 | NA | 2.45E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104179321 | NA | 3.55E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104179321 | 5.65E-06 | 8.12E-10 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104179321 | 5.64E-06 | NA | mr1699 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104179321 | NA | 2.54E-06 | mr1826 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104179321 | 9.84E-07 | NA | mr1136_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104179321 | NA | 6.72E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104179321 | NA | 4.00E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104179321 | NA | 8.24E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |