\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104179321:

Variant ID: vg1104179321 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4179321
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTAATAACCAATTCATACAATAGTTGCTTACTATACTATTAATATATGGTCCCACCTGTTATACATACATTGTGTCTTAGAGTCCGTGCTACAGCTG[C/G]
CTACAAATCTGTAGCCCACTGCTCTTCTCTCTCATCGTTTATCTCATTAAAATATGTTTATAGCTAGCTAATAGCCTGCTATTGTACCTGCTCTTAGAAG

Reverse complement sequence

CTTCTAAGAGCAGGTACAATAGCAGGCTATTAGCTAGCTATAAACATATTTTAATGAGATAAACGATGAGAGAGAAGAGCAGTGGGCTACAGATTTGTAG[G/C]
CAGCTGTAGCACGGACTCTAAGACACAATGTATGTATAACAGGTGGGACCATATATTAATAGTATAGTAAGCAACTATTGTATGAATTGGTTATTAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.00% 7.40% 1.63% 59.01% NA
All Indica  2759 11.80% 0.40% 1.99% 85.86% NA
All Japonica  1512 66.10% 21.50% 0.33% 12.10% NA
Aus  269 57.20% 1.10% 5.20% 36.43% NA
Indica I  595 21.50% 0.00% 2.69% 75.80% NA
Indica II  465 6.70% 0.20% 2.37% 90.75% NA
Indica III  913 9.10% 0.10% 0.88% 89.92% NA
Indica Intermediate  786 10.60% 1.00% 2.54% 85.88% NA
Temperate Japonica  767 96.60% 2.30% 0.00% 1.04% NA
Tropical Japonica  504 15.50% 53.40% 0.99% 30.16% NA
Japonica Intermediate  241 74.70% 15.80% 0.00% 9.54% NA
VI/Aromatic  96 7.30% 1.00% 1.04% 90.62% NA
Intermediate  90 30.00% 10.00% 2.22% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104179321 C -> DEL N N silent_mutation Average:14.501; most accessible tissue: Callus, score: 57.995 N N N N
vg1104179321 C -> G LOC_Os11g08020.1 upstream_gene_variant ; 4155.0bp to feature; MODIFIER silent_mutation Average:14.501; most accessible tissue: Callus, score: 57.995 N N N N
vg1104179321 C -> G LOC_Os11g08040.1 downstream_gene_variant ; 3288.0bp to feature; MODIFIER silent_mutation Average:14.501; most accessible tissue: Callus, score: 57.995 N N N N
vg1104179321 C -> G LOC_Os11g08050.1 downstream_gene_variant ; 4871.0bp to feature; MODIFIER silent_mutation Average:14.501; most accessible tissue: Callus, score: 57.995 N N N N
vg1104179321 C -> G LOC_Os11g08020-LOC_Os11g08040 intergenic_region ; MODIFIER silent_mutation Average:14.501; most accessible tissue: Callus, score: 57.995 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104179321 NA 4.58E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321 NA 2.45E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321 NA 3.55E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321 5.65E-06 8.12E-10 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321 5.64E-06 NA mr1699 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321 NA 2.54E-06 mr1826 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321 9.84E-07 NA mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321 NA 6.72E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321 NA 4.00E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321 NA 8.24E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251