Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1104179321:

Variant ID: vg1104179321 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4179321
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTAATAACCAATTCATACAATAGTTGCTTACTATACTATTAATATATGGTCCCACCTGTTATACATACATTGTGTCTTAGAGTCCGTGCTACAGCTG[C/G]
CTACAAATCTGTAGCCCACTGCTCTTCTCTCTCATCGTTTATCTCATTAAAATATGTTTATAGCTAGCTAATAGCCTGCTATTGTACCTGCTCTTAGAAG

Reverse complement sequence

CTTCTAAGAGCAGGTACAATAGCAGGCTATTAGCTAGCTATAAACATATTTTAATGAGATAAACGATGAGAGAGAAGAGCAGTGGGCTACAGATTTGTAG[G/C]
CAGCTGTAGCACGGACTCTAAGACACAATGTATGTATAACAGGTGGGACCATATATTAATAGTATAGTAAGCAACTATTGTATGAATTGGTTATTAAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.00%	7.40%	1.63%	59.01%	NA
All Indica	2759	11.80%	0.40%	1.99%	85.86%	NA
All Japonica	1512	66.10%	21.50%	0.33%	12.10%	NA
Aus	269	57.20%	1.10%	5.20%	36.43%	NA
Indica I	595	21.50%	0.00%	2.69%	75.80%	NA
Indica II	465	6.70%	0.20%	2.37%	90.75%	NA
Indica III	913	9.10%	0.10%	0.88%	89.92%	NA
Indica Intermediate	786	10.60%	1.00%	2.54%	85.88%	NA
Temperate Japonica	767	96.60%	2.30%	0.00%	1.04%	NA
Tropical Japonica	504	15.50%	53.40%	0.99%	30.16%	NA
Japonica Intermediate	241	74.70%	15.80%	0.00%	9.54%	NA
VI/Aromatic	96	7.30%	1.00%	1.04%	90.62%	NA
Intermediate	90	30.00%	10.00%	2.22%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104179321	C -> DEL	N	N	silent_mutation	Average:14.501; most accessible tissue: Callus, score: 57.995	N	N	N	N
vg1104179321	C -> G	LOC_Os11g08020.1	upstream_gene_variant ; 4155.0bp to feature; MODIFIER	silent_mutation	Average:14.501; most accessible tissue: Callus, score: 57.995	N	N	N	N
vg1104179321	C -> G	LOC_Os11g08040.1	downstream_gene_variant ; 3288.0bp to feature; MODIFIER	silent_mutation	Average:14.501; most accessible tissue: Callus, score: 57.995	N	N	N	N
vg1104179321	C -> G	LOC_Os11g08050.1	downstream_gene_variant ; 4871.0bp to feature; MODIFIER	silent_mutation	Average:14.501; most accessible tissue: Callus, score: 57.995	N	N	N	N
vg1104179321	C -> G	LOC_Os11g08020-LOC_Os11g08040	intergenic_region ; MODIFIER	silent_mutation	Average:14.501; most accessible tissue: Callus, score: 57.995	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104179321	NA	4.58E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321	NA	2.45E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321	NA	3.55E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321	5.65E-06	8.12E-10	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321	5.64E-06	NA	mr1699	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321	NA	2.54E-06	mr1826	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321	9.84E-07	NA	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321	NA	6.72E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321	NA	4.00E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104179321	NA	8.24E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251