\
| Variant ID: vg1104177036 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4177036 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.07, others allele: 0.00, population size: 103. )
AATATTTCAAATCCAAATTAAAACTATACATCAAGTAAAATATGTATGAACAAGATGGTTGGTGGAGGCGCCTCCAATCTCATTCCTCCAGAGTAAAATA[T/A]
ATACAGGATGGTTTTATTAGCTGTAAAAATTTCCCTTTGATACCCAAAATAAACTCTCTACACAATCATCCTTCTTATATCAATGAGTTTTATTCTGAAT
ATTCAGAATAAAACTCATTGATATAAGAAGGATGATTGTGTAGAGAGTTTATTTTGGGTATCAAAGGGAAATTTTTACAGCTAATAAAACCATCCTGTAT[A/T]
TATTTTACTCTGGAGGAATGAGATTGGAGGCGCCTCCACCAACCATCTTGTTCATACATATTTTACTTGATGTATAGTTTTAATTTGGATTTGAAATATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.20% | 39.80% | 0.61% | 0.36% | NA |
| All Indica | 2759 | 87.70% | 11.10% | 0.69% | 0.51% | NA |
| All Japonica | 1512 | 11.40% | 88.20% | 0.26% | 0.13% | NA |
| Aus | 269 | 24.20% | 75.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 77.80% | 19.30% | 1.85% | 1.01% | NA |
| Indica II | 465 | 94.00% | 4.50% | 1.08% | 0.43% | NA |
| Indica III | 913 | 91.20% | 8.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 87.30% | 11.70% | 0.25% | 0.76% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 29.00% | 70.00% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.90% | 91.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 35.60% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104177036 | T -> A | LOC_Os11g08020.1 | upstream_gene_variant ; 1870.0bp to feature; MODIFIER | silent_mutation | Average:35.588; most accessible tissue: Callus, score: 79.688 | N | N | N | N |
| vg1104177036 | T -> A | LOC_Os11g08020-LOC_Os11g08040 | intergenic_region ; MODIFIER | silent_mutation | Average:35.588; most accessible tissue: Callus, score: 79.688 | N | N | N | N |
| vg1104177036 | T -> DEL | N | N | silent_mutation | Average:35.588; most accessible tissue: Callus, score: 79.688 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104177036 | 2.12E-08 | 1.24E-10 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104177036 | NA | 4.78E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104177036 | NA | 1.63E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104177036 | NA | 6.94E-06 | mr1622 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104177036 | 1.48E-19 | 1.15E-57 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104177036 | 3.33E-12 | 1.06E-14 | mr1638 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104177036 | 2.48E-06 | 1.13E-08 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104177036 | 1.80E-06 | 4.98E-07 | mr1963 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104177036 | NA | 2.92E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104177036 | NA | 9.76E-08 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |