\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104177036:

Variant ID: vg1104177036 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4177036
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.07, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AATATTTCAAATCCAAATTAAAACTATACATCAAGTAAAATATGTATGAACAAGATGGTTGGTGGAGGCGCCTCCAATCTCATTCCTCCAGAGTAAAATA[T/A]
ATACAGGATGGTTTTATTAGCTGTAAAAATTTCCCTTTGATACCCAAAATAAACTCTCTACACAATCATCCTTCTTATATCAATGAGTTTTATTCTGAAT

Reverse complement sequence

ATTCAGAATAAAACTCATTGATATAAGAAGGATGATTGTGTAGAGAGTTTATTTTGGGTATCAAAGGGAAATTTTTACAGCTAATAAAACCATCCTGTAT[A/T]
TATTTTACTCTGGAGGAATGAGATTGGAGGCGCCTCCACCAACCATCTTGTTCATACATATTTTACTTGATGTATAGTTTTAATTTGGATTTGAAATATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 39.80% 0.61% 0.36% NA
All Indica  2759 87.70% 11.10% 0.69% 0.51% NA
All Japonica  1512 11.40% 88.20% 0.26% 0.13% NA
Aus  269 24.20% 75.10% 0.74% 0.00% NA
Indica I  595 77.80% 19.30% 1.85% 1.01% NA
Indica II  465 94.00% 4.50% 1.08% 0.43% NA
Indica III  913 91.20% 8.70% 0.11% 0.00% NA
Indica Intermediate  786 87.30% 11.70% 0.25% 0.76% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 29.00% 70.00% 0.79% 0.20% NA
Japonica Intermediate  241 7.90% 91.70% 0.00% 0.41% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 58.90% 35.60% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104177036 T -> A LOC_Os11g08020.1 upstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:35.588; most accessible tissue: Callus, score: 79.688 N N N N
vg1104177036 T -> A LOC_Os11g08020-LOC_Os11g08040 intergenic_region ; MODIFIER silent_mutation Average:35.588; most accessible tissue: Callus, score: 79.688 N N N N
vg1104177036 T -> DEL N N silent_mutation Average:35.588; most accessible tissue: Callus, score: 79.688 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104177036 2.12E-08 1.24E-10 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036 NA 4.78E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036 NA 1.63E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036 NA 6.94E-06 mr1622 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036 1.48E-19 1.15E-57 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036 3.33E-12 1.06E-14 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036 2.48E-06 1.13E-08 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036 1.80E-06 4.98E-07 mr1963 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036 NA 2.92E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036 NA 9.76E-08 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251