\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104157603:

Variant ID: vg1104157603 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4157603
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCGTCCACACAACAAACTCCTCCCTCTATCTCTTTTTTTCCTTTCTAACTTCTTGTCTCTTTCCTTATCTCTAACTCCTCTCCTCTCCTTCCTTTTTTC[C/T]
TTCACCCACAGTGCAGGCGGCCGGCGCGGAGGCGGCGACGCGGGGGACGGCACGGAGGAGGCCTGCGCGGCGGCGCGGGGGGCCGTGCGGCGGCTGCGGT

Reverse complement sequence

ACCGCAGCCGCCGCACGGCCCCCCGCGCCGCCGCGCAGGCCTCCTCCGTGCCGTCCCCCGCGTCGCCGCCTCCGCGCCGGCCGCCTGCACTGTGGGTGAA[G/A]
GAAAAAAGGAAGGAGAGGAGAGGAGTTAGAGATAAGGAAAGAGACAAGAAGTTAGAAAGGAAAAAAAGAGATAGAGGGAGGAGTTTGTTGTGTGGACGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 16.90% 0.30% 0.00% NA
All Indica  2759 93.50% 6.30% 0.11% 0.00% NA
All Japonica  1512 69.00% 30.40% 0.66% 0.00% NA
Aus  269 45.70% 54.30% 0.00% 0.00% NA
Indica I  595 83.20% 16.50% 0.34% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 96.70% 3.30% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.30% 0.13% 0.00% NA
Temperate Japonica  767 85.40% 13.80% 0.78% 0.00% NA
Tropical Japonica  504 52.00% 48.00% 0.00% 0.00% NA
Japonica Intermediate  241 52.30% 46.10% 1.66% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104157603 C -> T LOC_Os11g07980.1 upstream_gene_variant ; 2863.0bp to feature; MODIFIER silent_mutation Average:39.769; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1104157603 C -> T LOC_Os11g07980.2 upstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:39.769; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1104157603 C -> T LOC_Os11g08000.1 downstream_gene_variant ; 1643.0bp to feature; MODIFIER silent_mutation Average:39.769; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1104157603 C -> T LOC_Os11g07980-LOC_Os11g08000 intergenic_region ; MODIFIER silent_mutation Average:39.769; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104157603 NA 8.27E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 9.86E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 4.53E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 1.73E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 7.96E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 1.32E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 6.89E-06 mr1287 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 6.60E-06 6.60E-06 mr1290 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 8.62E-07 8.61E-07 mr1573 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 1.15E-13 NA mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 3.07E-09 6.11E-11 mr1638 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 1.39E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 6.24E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 6.02E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 6.16E-06 mr1963 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 2.14E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603 NA 1.48E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251