Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104157603:

Variant ID: vg1104157603 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4157603
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCGTCCACACAACAAACTCCTCCCTCTATCTCTTTTTTTCCTTTCTAACTTCTTGTCTCTTTCCTTATCTCTAACTCCTCTCCTCTCCTTCCTTTTTTC[C/T]
TTCACCCACAGTGCAGGCGGCCGGCGCGGAGGCGGCGACGCGGGGGACGGCACGGAGGAGGCCTGCGCGGCGGCGCGGGGGGCCGTGCGGCGGCTGCGGT

Reverse complement sequence

ACCGCAGCCGCCGCACGGCCCCCCGCGCCGCCGCGCAGGCCTCCTCCGTGCCGTCCCCCGCGTCGCCGCCTCCGCGCCGGCCGCCTGCACTGTGGGTGAA[G/A]
GAAAAAAGGAAGGAGAGGAGAGGAGTTAGAGATAAGGAAAGAGACAAGAAGTTAGAAAGGAAAAAAAGAGATAGAGGGAGGAGTTTGTTGTGTGGACGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.80%	16.90%	0.30%	0.00%	NA
All Indica	2759	93.50%	6.30%	0.11%	0.00%	NA
All Japonica	1512	69.00%	30.40%	0.66%	0.00%	NA
Aus	269	45.70%	54.30%	0.00%	0.00%	NA
Indica I	595	83.20%	16.50%	0.34%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	96.70%	3.30%	0.00%	0.00%	NA
Indica Intermediate	786	94.50%	5.30%	0.13%	0.00%	NA
Temperate Japonica	767	85.40%	13.80%	0.78%	0.00%	NA
Tropical Japonica	504	52.00%	48.00%	0.00%	0.00%	NA
Japonica Intermediate	241	52.30%	46.10%	1.66%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104157603	C -> T	LOC_Os11g07980.1	upstream_gene_variant ; 2863.0bp to feature; MODIFIER	silent_mutation	Average:39.769; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1104157603	C -> T	LOC_Os11g07980.2	upstream_gene_variant ; 2867.0bp to feature; MODIFIER	silent_mutation	Average:39.769; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1104157603	C -> T	LOC_Os11g08000.1	downstream_gene_variant ; 1643.0bp to feature; MODIFIER	silent_mutation	Average:39.769; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1104157603	C -> T	LOC_Os11g07980-LOC_Os11g08000	intergenic_region ; MODIFIER	silent_mutation	Average:39.769; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104157603	NA	8.27E-07	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	9.86E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	4.53E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	1.73E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	7.96E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	1.32E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	6.89E-06	mr1287	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	6.60E-06	6.60E-06	mr1290	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	8.62E-07	8.61E-07	mr1573	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	1.15E-13	NA	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	3.07E-09	6.11E-11	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	1.39E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	6.24E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	6.02E-06	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	6.16E-06	mr1963	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	2.14E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104157603	NA	1.48E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251