\
| Variant ID: vg1104144721 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4144721 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )
CATCGCTTTGCACTTTCCCCTTATGGAGTAAGGCATTCACAATGTCAGGCGAGCCGGCAACCACGGCGATGTGGAGCGGCGTGTTCCCAACCCCGTCCTG[C/T]
GCGTCCAGAAGGCCACCGACCTGCTTGTGTTTCTTGATAGCGAGGGACACGATCGAGGACTGCTTCTCCCTGACCGCGGTGTGCAGGAAGGTCTCTCCAT
ATGGAGAGACCTTCCTGCACACCGCGGTCAGGGAGAAGCAGTCCTCGATCGTGTCCCTCGCTATCAAGAAACACAAGCAGGTCGGTGGCCTTCTGGACGC[G/A]
CAGGACGGGGTTGGGAACACGCCGCTCCACATCGCCGTGGTTGCCGGCTCGCCTGACATTGTGAATGCCTTACTCCATAAGGGGAAAGTGCAAAGCGATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 38.40% | 0.21% | 0.85% | NA |
| All Indica | 2759 | 87.70% | 10.90% | 0.29% | 1.09% | NA |
| All Japonica | 1512 | 12.40% | 87.10% | 0.07% | 0.46% | NA |
| Aus | 269 | 40.90% | 58.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 77.60% | 19.70% | 0.50% | 2.18% | NA |
| Indica II | 465 | 92.90% | 5.20% | 0.22% | 1.72% | NA |
| Indica III | 913 | 91.20% | 8.50% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 88.00% | 10.60% | 0.51% | 0.89% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.00% | 67.50% | 0.20% | 1.39% | NA |
| Japonica Intermediate | 241 | 9.50% | 90.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 34.40% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104144721 | C -> T | LOC_Os11g07970.1 | upstream_gene_variant ; 4242.0bp to feature; MODIFIER | silent_mutation | Average:58.096; most accessible tissue: Callus, score: 81.544 | N | N | N | N |
| vg1104144721 | C -> T | LOC_Os11g07970-LOC_Os11g07980 | intergenic_region ; MODIFIER | silent_mutation | Average:58.096; most accessible tissue: Callus, score: 81.544 | N | N | N | N |
| vg1104144721 | C -> DEL | N | N | silent_mutation | Average:58.096; most accessible tissue: Callus, score: 81.544 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104144721 | NA | 4.27E-06 | mr1027 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | NA | 5.16E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | 3.61E-10 | 3.70E-12 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | 4.85E-06 | 8.41E-09 | mr1422 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | 1.00E-06 | 1.24E-11 | mr1583 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | NA | 7.70E-07 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | NA | 4.29E-06 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | 1.35E-06 | 1.35E-06 | mr1850 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | NA | 1.49E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | 9.19E-09 | 3.64E-12 | mr1218_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | NA | 2.65E-07 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104144721 | 3.04E-08 | 1.67E-14 | mr1850_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |